chrX-70027891-TCCAGGACCCCCAGGACCTCCAGGACCCC-T

Variant names:

• chrX-70027891-TCCAGGACCCCCAGGACCTCCAGGACCCC-T
• rs397516667
• NM_001399.5:c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC

Variant summary

Our verdict is Pathogenic. The variant received 12 ACMG points: 12P and 0B. PVS1 PM2 PP5_Moderate

The NM_001399.5(EDA):​c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC​(p.Pro188ArgfsTer83) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. P188P) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 21)
• Consequence: EDA NM_001399.5 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.96

Genes affected

EDA (HGNC:3157): (ectodysplasin A) The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

ACMG classification

Our verdict: Pathogenic. The variant received 12 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant X-70027891-TCCAGGACCCCCAGGACCTCCAGGACCCC-T is Pathogenic according to our data. Variant chrX-70027891-TCCAGGACCCCCAGGACCTCCAGGACCCC-T is described in ClinVar as [Pathogenic]. Clinvar id is 44199.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chrX-70027891-TCCAGGACCCCCAGGACCTCCAGGACCCC-T is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
EDA	NM_001399.5	c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC	p.Pro188ArgfsTer83	frameshift_variant	Exon 4 of 8	ENST00000374552.9	NP_001390.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
EDA	ENST00000374552.9	c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC	p.Pro188ArgfsTer83	frameshift_variant	Exon 4 of 8	1	NM_001399.5	ENSP00000363680.4

Frequencies

GnomAD3 genomes Cov.: 21

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 21

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hypohidrotic X-linked ectodermal dysplasia Pathogenic:1

Feb 22, 2012

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The Pro188fs variant (EDA) has been reported as a de novo variant in one individ ual with X-linked hypohidrotic ectodermal dysplasia (Monreal 1998). This framesh ift variant is predicted to alter the protein?s amino acid sequence beginning at position 188 and lead to a premature termination codon 83 amino acids downstrea m. This alteration is then predicted to lead to a truncated or absent protein. L oss of function of the EDA gene is an established disease mechanism in X-linked hypohidrotic ectodermal dysplasia. In summary, this variant meets our criteria t o be classified as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs397516667; hg19: chrX-69247741;