chrX-70027891-TCCAGGACCCCCAGGACCTCCAGGACCCC-T

Variant names:

• chrX-70027891-TCCAGGACCCCCAGGACCTCCAGGACCCC-T
• rs397516667
• NM_001399.5:c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The ENST00000374552.9(EDA):​c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC​(p.Pro188ArgfsTer83) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. P188P) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 21)
• Consequence: EDA ENST00000374552.9 frameshift
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 8.96
• Publications: 3 publications found

Genes affected

EDA (HGNC:3157): (ectodysplasin A) The protein encoded by this gene is a type II membrane protein that can be cleaved by furin to produce a secreted form. The encoded protein, which belongs to the tumor necrosis factor family, acts as a homotrimer and may be involved in cell-cell signaling during the development of ectodermal organs. Defects in this gene are a cause of ectodermal dysplasia, anhidrotic, which is also known as X-linked hypohidrotic ectodermal dysplasia. Several transcript variants encoding many different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

EDA Gene-Disease associations (from GenCC):

• tooth agenesis, selective, X-linked, 1

  Inheritance: XL Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• X-linked hypohidrotic ectodermal dysplasia

  Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Orphanet, Labcorp Genetics (formerly Invitae)
• tooth agenesis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant X-70027891-TCCAGGACCCCCAGGACCTCCAGGACCCC-T is Pathogenic according to our data. Variant chrX-70027891-TCCAGGACCCCCAGGACCTCCAGGACCCC-T is described in ClinVar as Pathogenic. ClinVar VariationId is 44199.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000374552.9. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EDA	NM_001399.5	MANE Select	c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC	p.Pro188ArgfsTer83	frameshift	Exon 4 of 8	NP_001390.1
	EDA	NM_001005609.2		c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC	p.Pro188ArgfsTer83	frameshift	Exon 4 of 8	NP_001005609.1
	EDA	NM_001440761.1		c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC	p.Pro188ArgfsTer80	frameshift	Exon 4 of 8	NP_001427690.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	EDA	ENST00000374552.9	TSL:1 MANE Select	c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC	p.Pro188ArgfsTer83	frameshift	Exon 4 of 8	ENSP00000363680.4
	EDA	ENST00000374553.6	TSL:1	c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC	p.Pro188ArgfsTer83	frameshift	Exon 4 of 8	ENSP00000363681.2
	EDA	ENST00000524573.5	TSL:1	c.562_589delCCAGGACCCCCAGGACCTCCAGGACCCC	p.Pro188ArgfsTer80	frameshift	Exon 4 of 8	ENSP00000432585.1

Frequencies

GnomAD3 genomes Cov.: 21

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 21

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Hypohidrotic X-linked ectodermal dysplasia (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.0
Mutation Taster		=1/199	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397516667; hg19: chrX-69247741;