X-71140758-ACAGCAGCAACAGCAACAGCAGCAG-A
Variant summary
Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2BP3
The NM_005120.3(MED12):c.6201_6224delACAGCAACAGCAGCAGCAGCAGCA(p.Gln2068_Gln2075del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000183 in 109,122 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_005120.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Uncertain_significance. Variant got 1 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.0000183 AC: 2AN: 109122Hom.: 0 Cov.: 22 AF XY: 0.00 AC XY: 0AN XY: 31870
GnomAD3 exomes AF: 0.00000558 AC: 1AN: 179249Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 66353
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000137 AC: 15AN: 1097265Hom.: 0 AF XY: 0.00000551 AC XY: 2AN XY: 362793
GnomAD4 genome AF: 0.0000183 AC: 2AN: 109122Hom.: 0 Cov.: 22 AF XY: 0.00 AC XY: 0AN XY: 31870
ClinVar
Submissions by phenotype
FG syndrome Uncertain:1
This variant, c.6201_6224del, results in the deletion of 8 amino acid(s) of the MED12 protein (p.Gln2069_Gln2076del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with MED12-related conditions. ClinVar contains an entry for this variant (Variation ID: 408883). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at