chrX-71140758-ACAGCAGCAACAGCAACAGCAGCAG-A
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_005120.3(MED12):c.6201_6224delACAGCAACAGCAGCAGCAGCAGCA(p.Gln2068_Gln2075del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.0000183 in 109,122 control chromosomes in the GnomAD database, with no homozygous occurrence. There are no hemizygote samples in GnomAD. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★). Synonymous variant affecting the same amino acid position (i.e. Q2067Q) has been classified as Likely benign.
Frequency
Consequence
NM_005120.3 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- FG syndrome 1Inheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Orphanet
- MED12-related intellectual disability syndromeInheritance: XL Classification: DEFINITIVE Submitted by: ClinGen
- X-linked intellectual disability with marfanoid habitusInheritance: XL Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Orphanet
- blepharophimosis - intellectual disability syndrome, MKB typeInheritance: XL Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet
- cholestasis-pigmentary retinopathy-cleft palate syndromeInheritance: XL Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Transcripts
RefSeq
Ensembl
Frequencies
GnomAD3 genomes AF: 0.0000183 AC: 2AN: 109122Hom.: 0 Cov.: 22 show subpopulations
GnomAD2 exomes AF: 0.00000558 AC: 1AN: 179249 AF XY: 0.00 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000137 AC: 15AN: 1097265Hom.: 0 AF XY: 0.00000551 AC XY: 2AN XY: 362793 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome AF: 0.0000183 AC: 2AN: 109122Hom.: 0 Cov.: 22 AF XY: 0.00 AC XY: 0AN XY: 31870 show subpopulations
ClinVar
Submissions by phenotype
FG syndrome Uncertain:1
This variant, c.6201_6224del, results in the deletion of 8 amino acid(s) of the MED12 protein (p.Gln2069_Gln2076del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has not been reported in the literature in individuals affected with MED12-related conditions. ClinVar contains an entry for this variant (Variation ID: 408883). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at