chr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCT-G

Variant names:

• chr1-154869723-GGCTGCTGCTGCTGCTGCTGCTGCT-G
• rs3831942
• NM_002249.6:c.218_241delAGCAGCAGCAGCAGCAGCAGCAGC

Variant summary

Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.

The NM_002249.6(KCNN3):​c.218_241delAGCAGCAGCAGCAGCAGCAGCAGC​(p.Gln73_Gln80del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000524 in 1,506,420 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000028 (0 hom., cov: 0)
  • Exomes 𝑓: 0.000055 (0 hom.)
• Consequence: KCNN3 NM_002249.6 disruptive_inframe_deletion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 3.39
• Publications: 18 publications found

Genes affected

KCNN3 (HGNC:6292): (potassium calcium-activated channel subfamily N member 3) Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]

KCNN3 Gene-Disease associations (from GenCC):

• Zimmermann-Laband syndrome 3

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), G2P, Ambry Genetics
• Zimmermann-Laband syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• schizophrenia

  Inheritance: Unknown Classification: LIMITED Submitted by: Labcorp Genetics (formerly Invitae)

ENSG00000308854 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
KCNN3	NM_002249.6	c.218_241delAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln73_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	ENST00000271915.9	NP_002240.3
KCNN3	NM_001204087.2	c.218_241delAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln73_Gln80del	disruptive_inframe_deletion	Exon 1 of 9		NP_001191016.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
KCNN3	ENST00000271915.9	c.218_241delAGCAGCAGCAGCAGCAGCAGCAGC	p.Gln73_Gln80del	disruptive_inframe_deletion	Exon 1 of 8	1	NM_002249.6	ENSP00000271915.3

Frequencies

GnomAD3 genomes AF: 0.0000283 AC: 4 AN: 141288 Hom.: 0 Cov.: 0

Gnomad AFR AF: 0.0000530

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000307

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000549 AC: 75 AN: 1365132 Hom.: 0 AF XY: 0.0000533 AC XY: 36 AN XY: 674890

African (AFR) AF: 0.0000964 AC: 3 AN: 31108

American (AMR) AF: 0.00 AC: 0 AN: 35514

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24960

East Asian (EAS) AF: 0.0000562 AC: 2 AN: 35568

South Asian (SAS) AF: 0.0000127 AC: 1 AN: 78750

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 46138

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 4434

European-Non Finnish (NFE) AF: 0.0000627 AC: 66 AN: 1051856

Other (OTH) AF: 0.0000528 AC: 3 AN: 56804

GnomAD4 genome AF: 0.0000283 AC: 4 AN: 141288 Hom.: 0 Cov.: 0 AF XY: 0.0000295 AC XY: 2 AN XY: 67900

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000530 AC: 2 AN: 37728

American (AMR) AF: 0.00 AC: 0 AN: 14140

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3376

East Asian (EAS) AF: 0.00 AC: 0 AN: 4628

South Asian (SAS) AF: 0.00 AC: 0 AN: 4048

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 9120

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 302

European-Non Finnish (NFE) AF: 0.0000307 AC: 2 AN: 65194

Other (OTH) AF: 0.00 AC: 0 AN: 1882

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0.000173), which strongly suggests a high chance of mosaicism in these individuals.

Alfa AF: 0.00 Hom.: 292

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.4
Mutation Taster		=161/39	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs3831942; hg19: chr1-154842199;