chr1-156114913-CCGGCCATGGAGACCCCGTCCCAG-C

Position:

• chr1-156114913-CCGGCCATGGAGACCCCGTCCCAG-C

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1 PS1_Moderate PM2 PP5_Moderate

The NM_170707.4(LMNA):​c.-1_22delCATGGAGACCCCGTCCCAGCGGC​(p.Met1fs) variant causes a frameshift, start lost change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: LMNA NM_170707.4 frameshift, start_lost
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 7.06

Genes affected

LMNA (HGNC:6636): (lamin A/C) The protein encoded by this gene is part of the nuclear lamina, a two-dimensional matrix of proteins located next to the inner nuclear membrane. The lamin family of proteins make up the matrix and are highly conserved in evolution. During mitosis, the lamina matrix is reversibly disassembled as the lamin proteins are phosphorylated. Lamin proteins are thought to be involved in nuclear stability, chromatin structure and gene expression. Vertebrate lamins consist of two types, A and B. Alternative splicing results in multiple transcript variants. Mutations in this gene lead to several diseases: Emery-Dreifuss muscular dystrophy, familial partial lipodystrophy, limb girdle muscular dystrophy, dilated cardiomyopathy, Charcot-Marie-Tooth disease, and Hutchinson-Gilford progeria syndrome. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Pathogenic. Variant got 14 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 804 pathogenic variants in the truncated region.
• PS1: Another start lost variant in NM_170707.4 (LMNA) was described as [Likely_pathogenic] in ClinVar as 200949
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 1-156114913-CCGGCCATGGAGACCCCGTCCCAG-C is Pathogenic according to our data. Variant chr1-156114913-CCGGCCATGGAGACCCCGTCCCAG-C is described in ClinVar as [Likely_pathogenic]. Clinvar id is 2690636.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
LMNA	NM_170707.4	c.-1_22delCATGGAGACCCCGTCCCAGCGGC	p.Met1fs	frameshift_variant, start_lost	1/12	ENST00000368300.9	NP_733821.1
LMNA	NM_005572.4	c.-1_22delCATGGAGACCCCGTCCCAGCGGC	p.Met1fs	frameshift_variant, start_lost	1/10	ENST00000677389.1	NP_005563.1
LMNA	NM_170707.4	c.-1_22delCATGGAGACCCCGTCCCAGCGGC		5_prime_UTR_variant	1/12	ENST00000368300.9	NP_733821.1
LMNA	NM_005572.4	c.-1_22delCATGGAGACCCCGTCCCAGCGGC		5_prime_UTR_variant	1/10	ENST00000677389.1	NP_005563.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
LMNA	ENST00000368300.9	c.-1_22delCATGGAGACCCCGTCCCAGCGGC	p.Met1fs	frameshift_variant, start_lost	1/12	1	NM_170707.4	ENSP00000357283.4
LMNA	ENST00000677389.1	c.-1_22delCATGGAGACCCCGTCCCAGCGGC	p.Met1fs	frameshift_variant, start_lost	1/10		NM_005572.4	ENSP00000503633.1
LMNA	ENST00000368300	c.-1_22delCATGGAGACCCCGTCCCAGCGGC		5_prime_UTR_variant	1/12	1	NM_170707.4	ENSP00000357283.4
LMNA	ENST00000677389	c.-1_22delCATGGAGACCCCGTCCCAGCGGC		5_prime_UTR_variant	1/10		NM_005572.4	ENSP00000503633.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Revvity Omics, Revvity

Jun 13, 2023

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

No publications associated with this variant yet.

Other links and lift over

hg19: chr1-156084704;