chr1-17018697-CTGCGGCAAGTAAAGGAACAGGTTCT-TTGGGGCAAGTAAAGGAACAGGTTC
Variant summary
Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2
The NM_003000.3(SDHB):c.*159_*184delAGAACCTGTTCCTTTACTTGCCGCAGinsGAACCTGTTCCTTTACTTGCCCCAA variant causes a splice region change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Genomes: not found (cov: 32)
Consequence
SDHB
NM_003000.3 splice_region
NM_003000.3 splice_region
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 2.14
Genes affected
SDHB (HGNC:10681): (succinate dehydrogenase complex iron sulfur subunit B) This tumor suppressor gene encodes the iron-sulfur protein subunit of the succinate dehydrogenase (SDH) enzyme complex which plays a critical role in mitochondria. The SDH enzyme complex is composed of four nuclear-encoded subunits. This enzyme complex converts succinate to fumarate which releases electrons as part of the citric acid cycle, and the enzyme complex additionally provides an attachment site for released electrons to be transferred to the oxidative phosphorylation pathway. The SDH enzyme complex plays a role in oxygen-related gene regulation through its conversion of succinate, which is an oxygen sensor that stabilizes the hypoxia-inducible factor 1 (HIF1) transcription factor. Sporadic and familial mutations in this gene result in paragangliomas, pheochromocytoma, and gastrointestinal stromal tumors, supporting a link between mitochondrial dysfunction and tumorigenesis. Mutations in this gene are also implicated in nuclear type 4 mitochondrial complex II deficiency. [provided by RefSeq, Jun 2022]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Uncertain_significance. Variant got 2 ACMG points.
PM2
Very rare variant in population databases, with high coverage;
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
SDHB | NM_003000.3 | c.*159_*184delAGAACCTGTTCCTTTACTTGCCGCAGinsGAACCTGTTCCTTTACTTGCCCCAA | splice_region_variant | 8/8 | ENST00000375499.8 | NP_002991.2 | ||
SDHB | NM_003000.3 | c.*159_*184delAGAACCTGTTCCTTTACTTGCCGCAGinsGAACCTGTTCCTTTACTTGCCCCAA | 3_prime_UTR_variant | 8/8 | ENST00000375499.8 | NP_002991.2 | ||
SDHB | NM_003000.3 | c.*159_*184delAGAACCTGTTCCTTTACTTGCCGCAGinsGAACCTGTTCCTTTACTTGCCCCAA | non_coding_transcript_variant | ENST00000375499.8 | NP_002991.2 | |||
SDHB | NM_003000.3 | c.*159_*184delAGAACCTGTTCCTTTACTTGCCGCAGinsGAACCTGTTCCTTTACTTGCCCCAA | downstream_gene_variant | ENST00000375499.8 | NP_002991.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
SDHB | ENST00000375499.8 | c.*159_*184delAGAACCTGTTCCTTTACTTGCCGCAGinsGAACCTGTTCCTTTACTTGCCCCAA | splice_region_variant | 8/8 | 1 | NM_003000.3 | ENSP00000364649.3 | |||
SDHB | ENST00000375499 | c.*159_*184delAGAACCTGTTCCTTTACTTGCCGCAGinsGAACCTGTTCCTTTACTTGCCCCAA | 3_prime_UTR_variant | 8/8 | 1 | NM_003000.3 | ENSP00000364649.3 | |||
SDHB | ENST00000375499.8 | c.*159_*184delAGAACCTGTTCCTTTACTTGCCGCAGinsGAACCTGTTCCTTTACTTGCCCCAA | non_coding_transcript_variant | 1 | NM_003000.3 | ENSP00000364649.3 | ||||
SDHB | ENST00000375499.8 | c.*159_*184delAGAACCTGTTCCTTTACTTGCCGCAGinsGAACCTGTTCCTTTACTTGCCCCAA | downstream_gene_variant | 1 | NM_003000.3 | ENSP00000364649.3 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome Cov.: 32
GnomAD4 genome
Cov.:
32
ClinVar
Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link
Submissions by phenotype
not provided Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine | Feb 27, 2024 | The c.*159_*184delins25 variant in SDHB has been identified in >10 individuals with pheochromocytomas, paragangliomas, or GIST, 7 of whom carried a second variant sufficient to explain disease (Hernandez 2015 PMID 25800244, LMM data). Data from large population studies is insufficient to assess the frequency of this variant. This variant is located in the 3' untranslated region (3' UTR) and while this region may contain important regulatory sequences, no pathogenic variants in the SDHB gene have been reported in this region. In summary, while the clinical significance of the c.*159_*184delins25 variant is uncertain, these data suggest that it is more likely to be benign. ACMG/AMP criteria applied: BP5 - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at