chr1-196747290-TATCCAACTTGTGCAAAAAGATAGA-T
Variant summary
Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4
The NM_000186.4(CFH):c.3677_*4delCAACTTGTGCAAAAAGATAGAATC(p.Pro1226_Ter1232delins???) variant causes a stop lost, conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as risk factor (no stars).
Frequency
Consequence
NM_000186.4 stop_lost, conservative_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- primary membranoproliferative glomerulonephritisInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- atypical hemolytic-uremic syndromeInheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
- hemolytic uremic syndrome, atypical, susceptibility to, 1Inheritance: AD Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- complement factor H deficiencyInheritance: AR Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- basal laminar drusenInheritance: Unknown, AD Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- Doyne honeycomb retinal dystrophyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- dense deposit diseaseInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 2 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| CFH | NM_000186.4 | c.3677_*4delCAACTTGTGCAAAAAGATAGAATC | p.Pro1226_Ter1232delins??? | stop_lost, conservative_inframe_deletion | Exon 22 of 22 | ENST00000367429.9 | NP_000177.2 | |
| CFH | NM_000186.4 | c.3677_*4delCAACTTGTGCAAAAAGATAGAATC | 3_prime_UTR_variant | Exon 22 of 22 | ENST00000367429.9 | NP_000177.2 |
Ensembl
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
|---|---|---|---|---|---|---|---|---|---|---|
| CFH | ENST00000367429.9 | c.3677_*4delCAACTTGTGCAAAAAGATAGAATC | p.Pro1226_Ter1232delins??? | stop_lost, conservative_inframe_deletion | Exon 22 of 22 | 1 | NM_000186.4 | ENSP00000356399.4 | ||
| CFH | ENST00000367429.9 | c.3677_*4delCAACTTGTGCAAAAAGATAGAATC | 3_prime_UTR_variant | Exon 22 of 22 | 1 | NM_000186.4 | ENSP00000356399.4 | |||
| ENSG00000289697 | ENST00000696032.1 | c.3580+97_3580+120delCAACTTGTGCAAAAAGATAGAATC | intron_variant | Intron 22 of 26 | ENSP00000512341.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Hemolytic uremic syndrome, atypical, susceptibility to, 1 Other:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at