rs796052136

Variant names:

• chr1-196747290-TATCCAACTTGTGCAAAAAGATAGA-T
• rs796052136
• NM_000186.4:c.3677_*4delCAACTTGTGCAAAAAGATAGAATC

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PM4

The NM_000186.4(CFH):​c.3677_*4delCAACTTGTGCAAAAAGATAGAATC​(p.Pro1226_Ter1232delins???) variant causes a stop lost, conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as risk factor (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: CFH NM_000186.4 stop_lost, conservative_inframe_deletion
• Clinical Significance: risk factor no assertion criteria provided O:1
• Conservation: PhyloP100: 5.38
• Publications: 0 publications found

Genes affected

CFH (HGNC:4883): (complement factor H) This gene is a member of the Regulator of Complement Activation (RCA) gene cluster and encodes a protein with twenty short consensus repeat (SCR) domains. This protein is secreted into the bloodstream and has an essential role in the regulation of complement activation, restricting this innate defense mechanism to microbial infections. Mutations in this gene have been associated with hemolytic-uremic syndrome (HUS) and chronic hypocomplementemic nephropathy. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Oct 2011]

CFH Gene-Disease associations (from GenCC):

• C3 glomerulonephritis

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• atypical hemolytic-uremic syndrome

  Inheritance: SD Classification: DEFINITIVE Submitted by: ClinGen
• basal laminar drusen

  Inheritance: AD, Unknown Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• hemolytic uremic syndrome, atypical, susceptibility to, 1

  Inheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• complement factor H deficiency

  Inheritance: AR Classification: STRONG, MODERATE Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
• Doyne honeycomb retinal dystrophy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• dense deposit disease

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000289697 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM4: Stoplost variant in NM_000186.4 Downstream stopcodon found after 20 codons.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000186.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CFH	NM_000186.4	MANE Select	c.3677_*4delCAACTTGTGCAAAAAGATAGAATC	p.Pro1226_Ter1232delins???	stop_lost conservative_inframe_deletion	Exon 22 of 22	NP_000177.2
	CFH	NM_000186.4	MANE Select	c.3677_*4delCAACTTGTGCAAAAAGATAGAATC		3_prime_UTR	Exon 22 of 22	NP_000177.2

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CFH	ENST00000367429.9	TSL:1 MANE Select	c.3677_*4delCAACTTGTGCAAAAAGATAGAATC	p.Pro1226_Ter1232delins???	stop_lost conservative_inframe_deletion	Exon 22 of 22	ENSP00000356399.4	P08603
	CFH	ENST00000367429.9	TSL:1 MANE Select	c.3677_*4delCAACTTGTGCAAAAAGATAGAATC		3_prime_UTR	Exon 22 of 22	ENSP00000356399.4	P08603
	ENSG00000289697	ENST00000696032.1		c.3580+97_3580+120delCAACTTGTGCAAAAAGATAGAATC		intron	N/A	ENSP00000512341.1	A0A8Q3SIA1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: risk factor

Revision: no assertion criteria provided

Pathogenic	VUS	Benign	Condition
-	-	-	Hemolytic uremic syndrome, atypical, susceptibility to, 1 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.4

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs796052136; hg19: chr1-196716420;