rs796052136

Variant names:

• chr1-196747290-TATCCAACTTGTGCAAAAAGATAGA-T
• rs796052136
• NM_000186.4:c.3677_*4delCAACTTGTGCAAAAAGATAGAATC

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM1 PM2 PM4

The NM_000186.4(CFH):​c.3677_*4delCAACTTGTGCAAAAAGATAGAATC​(p.Pro1226_Ter1232delins???) variant causes a stop lost, conservative inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as risk factor (no stars).

• Frequency: Genomes: not found (cov: 32)
• Consequence: CFH NM_000186.4 stop_lost, conservative_inframe_deletion
• Clinical Significance: risk factor no assertion criteria provided O:1
• Conservation: PhyloP100: 5.38

Genes affected

CFH (HGNC:4883): (complement factor H) This gene is a member of the Regulator of Complement Activation (RCA) gene cluster and encodes a protein with twenty short consensus repeat (SCR) domains. This protein is secreted into the bloodstream and has an essential role in the regulation of complement activation, restricting this innate defense mechanism to microbial infections. Mutations in this gene have been associated with hemolytic-uremic syndrome (HUS) and chronic hypocomplementemic nephropathy. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Oct 2011]

ENSG00000289697 (HGNC:):

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM1: In a domain Sushi 20 (size 60) in uniprot entity CFAH_HUMAN there are 30 pathogenic changes around while only 2 benign (94%) in NM_000186.4
• PM2: Very rare variant in population databases, with high coverage
• PM4: Stoplost variant in NM_000186.4 Downstream stopcodon found after 20 codons.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CFH	NM_000186.4	c.3677_*4delCAACTTGTGCAAAAAGATAGAATC	p.Pro1226_Ter1232delins???	stop_lost, conservative_inframe_deletion	Exon 22 of 22	ENST00000367429.9	NP_000177.2
CFH	NM_000186.4	c.3677_*4delCAACTTGTGCAAAAAGATAGAATC		3_prime_UTR_variant	Exon 22 of 22	ENST00000367429.9	NP_000177.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CFH	ENST00000367429.9	c.3677_*4delCAACTTGTGCAAAAAGATAGAATC	p.Pro1226_Ter1232delins???	stop_lost, conservative_inframe_deletion	Exon 22 of 22	1	NM_000186.4	ENSP00000356399.4
CFH	ENST00000367429.9	c.3677_*4delCAACTTGTGCAAAAAGATAGAATC		3_prime_UTR_variant	Exon 22 of 22	1	NM_000186.4	ENSP00000356399.4
ENSG00000289697	ENST00000696032.1	c.3580+97_3580+120delCAACTTGTGCAAAAAGATAGAATC		intron_variant	Intron 22 of 26			ENSP00000512341.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: risk factor

Submissions summary: Other:1

Revision: no assertion criteria provided

Submissions by phenotype

Hemolytic uremic syndrome, atypical, susceptibility to, 1 Other:1

May 01, 2000

OMIM

Significance: risk factor

Review Status: no assertion criteria provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs796052136; hg19: chr1-196716420;