chr10-77637591-CGCCGCCGCCGCCGCCGCTGCT-C

Variant names:

• chr10-77637591-CGCCGCCGCCGCCGCCGCTGCT-C
• rs1484259264
• NM_001161352.2:c.31_51delAGCAGCGGCGGCGGCGGCGGC

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001161352.2(KCNMA1):​c.31_51delAGCAGCGGCGGCGGCGGCGGC​(p.Ser11_Gly17del) variant causes a conservative inframe deletion change. The variant allele was found at a frequency of 0.000201 in 1,524,956 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.00014 (0 hom., cov: 32)
  • Exomes 𝑓: 0.00021 (0 hom.)
• Consequence: KCNMA1 NM_001161352.2 conservative_inframe_deletion
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications U:4 B:1
• Conservation: PhyloP100: 4.78
• Publications: 1 publications found

Genes affected

KCNMA1 (HGNC:6284): (potassium calcium-activated channel subfamily M alpha 1) This gene encodes the alpha subunit of calcium-activated BK channel. The encoded protein is involved in several physiological processes including smooth muscle contraction, neurotransmitter release and neuronal excitability. Mutations in this gene are associated with a spectrum of neurological disorders including Paroxysmal Nonkinesigenic Dyskinesia 3, Idiopathic Generalized Epilepsy 16 and Liang-Wang syndrome. [provided by RefSeq, Aug 2022]

KCNMA1 Gene-Disease associations (from GenCC):

• generalized epilepsy-paroxysmal dyskinesia syndrome

  Inheritance: AD, AR Classification: DEFINITIVE, STRONG, MODERATE, SUPPORTIVE Submitted by: Illumina, G2P, Ambry Genetics, Orphanet, Labcorp Genetics (formerly Invitae), ClinGen
• Liang-Wang syndrome

  Inheritance: AD Classification: STRONG Submitted by: Ambry Genetics
• cerebellar atrophy, developmental delay, and seizures

  Inheritance: AR Classification: STRONG, MODERATE Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001161352.2

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001161352.2. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNMA1	NM_001161352.2	MANE Select	c.31_51delAGCAGCGGCGGCGGCGGCGGC	p.Ser11_Gly17del	conservative_inframe_deletion	Exon 1 of 28	NP_001154824.1
	KCNMA1	NM_001437422.1		c.31_51delAGCAGCGGCGGCGGCGGCGGC	p.Ser11_Gly17del	conservative_inframe_deletion	Exon 1 of 28	NP_001424351.1
	KCNMA1	NM_001161353.2		c.31_51delAGCAGCGGCGGCGGCGGCGGC	p.Ser11_Gly17del	conservative_inframe_deletion	Exon 1 of 28	NP_001154825.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	KCNMA1	ENST00000286628.14	TSL:1 MANE Select	c.31_51delAGCAGCGGCGGCGGCGGCGGC	p.Ser11_Gly17del	conservative_inframe_deletion	Exon 1 of 28	ENSP00000286628.8
	KCNMA1	ENST00000626620.3	TSL:1	c.31_51delAGCAGCGGCGGCGGCGGCGGC	p.Ser11_Gly17del	conservative_inframe_deletion	Exon 1 of 28	ENSP00000485867.1
	KCNMA1	ENST00000639406.1	TSL:1	c.31_51delAGCAGCGGCGGCGGCGGCGGC	p.Ser11_Gly17del	conservative_inframe_deletion	Exon 1 of 29	ENSP00000491732.1

Frequencies

GnomAD3 genomes AF: 0.000138 AC: 21 AN: 151640 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.000266

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.000262

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000208

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000737

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.000161 AC: 20 AN: 124434 AF XY: 0.000147

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.000216

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.000399

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.000212

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.000208 AC: 285 AN: 1373208 Hom.: 0 AF XY: 0.000222 AC XY: 150 AN XY: 677092

African (AFR) AF: 0.000226 AC: 7 AN: 30908

American (AMR) AF: 0.000347 AC: 12 AN: 34598

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 24516

East Asian (EAS) AF: 0.000199 AC: 7 AN: 35256

South Asian (SAS) AF: 0.0000899 AC: 7 AN: 77862

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 35576

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5128

European-Non Finnish (NFE) AF: 0.000229 AC: 246 AN: 1072090

Other (OTH) AF: 0.000105 AC: 6 AN: 57274

GnomAD4 genome AF: 0.000138 AC: 21 AN: 151748 Hom.: 0 Cov.: 32 AF XY: 0.0000674 AC XY: 5 AN XY: 74154

African (AFR) AF: 0.000266 AC: 11 AN: 41414

American (AMR) AF: 0.000262 AC: 4 AN: 15264

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3468

East Asian (EAS) AF: 0.00 AC: 0 AN: 5096

South Asian (SAS) AF: 0.000208 AC: 1 AN: 4808

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10570

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 292

European-Non Finnish (NFE) AF: 0.0000737 AC: 5 AN: 67820

Other (OTH) AF: 0.00 AC: 0 AN: 2104

Alfa AF: 0.000169 Hom.: 0

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Uncertain:4 Benign:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Uncertain:2 Benign:1

Nov 18, 2024

GeneDx

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Observed as heterozygous variant in one patient with epilepsy and developmental delay in published literature; however, no further information was provided (PMID: 34224328); In-frame deletion of 7 amino acids in a non-repeat region; In silico analysis indicates that this variant does not alter protein structure/function; This variant is associated with the following publications: (PMID: 34224328)

Nov 21, 2019

Athena Diagnostics

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Apr 09, 2018

Eurofins Ntd Llc (ga)

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Cerebellar atrophy, developmental delay, and seizures Uncertain:1

Oct 11, 2019

New York Genome Center

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Generalized epilepsy-paroxysmal dyskinesia syndrome Uncertain:1

Feb 02, 2025

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.31_51del, results in the deletion of 7 amino acid(s) of the KCNMA1 protein (p.Ser11_Gly17del), but otherwise preserves the integrity of the reading frame. The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the gnomAD database. This variant has been observed in individual(s) with clinical features of KCNMA1-related conditions (internal data). ClinVar contains an entry for this variant (Variation ID: 464298). Experimental studies and prediction algorithms are not available or were not evaluated, and the functional significance of this variant is currently unknown. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance.

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		4.8
Mutation Taster		=158/42	polymorphism

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1484259264; hg19: chr10-79397349;