chr10-86716377-CCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTG-C

Position:

• chr10-86716377-CCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTG-C

Variant summary

Our verdict is Benign. Variant got -10 ACMG points: 2P and 12B. PM4 BP6_Very_Strong BS2

The NM_007078.3(LDB3):​c.1296_1343delCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTC​(p.Pro433_Ser448del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000028 in 1,607,980 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Benign (★★).

• Frequency:
  • Genomes: 𝑓 0.0000067 (0 hom., cov: 26)
  • Exomes 𝑓: 0.000030 (0 hom.)
• Consequence: LDB3 NM_007078.3 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 2.40

Genes affected

LDB3 (HGNC:15710): (LIM domain binding 3) This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. [provided by RefSeq, Jan 2010]

ACMG classification

Verdict is Benign. Variant got -10 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_007078.3.
• BP6: Variant 10-86716377-CCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTG-C is Benign according to our data. Variant chr10-86716377-CCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTG-C is described in ClinVar as [Benign]. Clinvar id is 257340.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr10-86716377-CCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTG-C is described in Lovd as [Likely_benign].
• BS2: High AC in GnomAdExome4 at 44 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
LDB3	NM_007078.3	c.1296_1343delCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTC	p.Pro433_Ser448del	disruptive_inframe_deletion	10/14	ENST00000361373.9	NP_009009.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
LDB3	ENST00000361373.9	c.1296_1343delCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTC	p.Pro433_Ser448del	disruptive_inframe_deletion	10/14	1	NM_007078.3	ENSP00000355296.3

Frequencies

GnomAD3 genomes AF: 0.00000667 AC: 1 AN: 149866 Hom.: 0 Cov.: 26

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000148

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.0000302 AC: 44 AN: 1458114 Hom.: 0 AF XY: 0.0000331 AC XY: 24 AN XY: 725222

Gnomad4 AFR exome AF: 0.0000300

Gnomad4 AMR exome AF: 0.0000897

Gnomad4 ASJ exome AF: 0.000115

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000814

Gnomad4 FIN exome AF: 0.0000565

Gnomad4 NFE exome AF: 0.0000216

Gnomad4 OTH exome AF: 0.0000166

GnomAD4 genome AF: 0.00000667 AC: 1 AN: 149866 Hom.: 0 Cov.: 26 AF XY: 0.0000137 AC XY: 1 AN XY: 73046

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000148

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Benign

Submissions summary: Benign:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not specified Benign:2

Benign, criteria provided, single submitter	clinical testing	PreventionGenetics, part of Exact Sciences	-	- -
Benign, criteria provided, single submitter	clinical testing	Women's Health and Genetics/Laboratory Corporation of America, LabCorp	Sep 23, 2019	Variant summary: LDB3 c.1296_1343del48 (p.Ala434_Pro449del) results in an in-frame deletion that is predicted to remove 16 amino acids from the encoded protein. The variant allele was found at a frequency of 8.2e-05 in 244960 control chromosomes. The observed variant frequency is approximately 3.3 fold of the estimated maximal expected allele frequency for a pathogenic variant in LDB3 causing Cardiomyopathy phenotype (2.5e-05), strongly suggesting that the variant is benign. To our knowledge, no occurrence of c.1296_1343del48 in individuals affected with Cardiomyopathy and no experimental evidence demonstrating its impact on protein function have been reported. One clinical diagnostic laboratory has submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation and classified the variant as benign. Based on the evidence outlined above, the variant was classified as benign. -

Cardiomyopathy Benign:1

Benign, criteria provided, single submitter

clinical testing

CHEO Genetics Diagnostic Laboratory, Children's Hospital of Eastern Ontario

Jul 31, 2020

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs397517209; hg19: chr10-88476134;