rs397517209

Variant names:

• chr10-86716377-CCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTG-C
• rs397517209
• NM_007078.3:c.1296_1343delCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTC

Your query was ambiguous. Multiple possible variants found:

• chr10-86716377-CCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTG-C
• chr10-86716377-CCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTG-CCCTACACCCCCTCCCCTGCCCCTG
• chr10-86716377-CCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTG-CCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTG

Variant summary

Our verdict is Likely benign. The variant received -6 ACMG points: 2P and 8B. PM4 BP6_Very_Strong

The NM_007078.3(LDB3):​c.1296_1343delCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTC​(p.Pro433_Ser448del) variant causes a disruptive inframe deletion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.000028 in 1,607,980 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Benign (★★). Synonymous variant affecting the same amino acid position (i.e. S432S) has been classified as Likely benign.

• Frequency:
  • Genomes: 𝑓 0.0000067 (0 hom., cov: 26)
  • Exomes 𝑓: 0.000030 (0 hom.)
• Consequence: LDB3 NM_007078.3 disruptive_inframe_deletion
• Clinical Significance: Benign criteria provided, multiple submitters, no conflicts B:3
• Conservation: PhyloP100: 2.40
• Publications: 0 publications found

Genes affected

LDB3 (HGNC:15710): (LIM domain binding 3) This gene encodes a PDZ domain-containing protein. PDZ motifs are modular protein-protein interaction domains consisting of 80-120 amino acid residues. PDZ domain-containing proteins interact with each other in cytoskeletal assembly or with other proteins involved in targeting and clustering of membrane proteins. The protein encoded by this gene interacts with alpha-actinin-2 through its N-terminal PDZ domain and with protein kinase C via its C-terminal LIM domains. The LIM domain is a cysteine-rich motif defined by 50-60 amino acids containing two zinc-binding modules. This protein also interacts with all three members of the myozenin family. Mutations in this gene have been associated with myofibrillar myopathy and dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been identified; all isoforms have N-terminal PDZ domains while only longer isoforms (1, 2 and 5) have C-terminal LIM domains. [provided by RefSeq, Jan 2010]

LDB3 Gene-Disease associations (from GenCC):

• dilated cardiomyopathy

  Inheritance: AD, AR Classification: STRONG, LIMITED Submitted by: ClinGen
• myofibrillar myopathy 4

  Inheritance: AD Classification: STRONG, MODERATE, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics, G2P
• familial isolated dilated cardiomyopathy

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• familial dilated cardiomyopathy

  Inheritance: AR Classification: LIMITED Submitted by: Ambry Genetics
• arrhythmogenic right ventricular cardiomyopathy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ACMG classification

Our verdict: Likely_benign. The variant received -6 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_007078.3.
• BP6: Variant 10-86716377-CCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTG-C is Benign according to our data. Variant chr10-86716377-CCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTG-C is described in ClinVar as Benign. ClinVar VariationId is 257340.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_007078.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDB3	NM_007078.3	MANE Select	c.1296_1343delCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTC	p.Pro433_Ser448del	disruptive_inframe_deletion	Exon 10 of 14	NP_009009.1	O75112-1
	LDB3	NM_001171610.2		c.1311_1358delCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTC	p.Pro438_Ser453del	disruptive_inframe_deletion	Exon 10 of 14	NP_001165081.1	O75112-7
	LDB3	NM_001368066.1		c.1155_1202delCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTC	p.Pro386_Ser401del	disruptive_inframe_deletion	Exon 11 of 15	NP_001354995.1	A0A8I5KV04

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	LDB3	ENST00000361373.9	TSL:1 MANE Select	c.1296_1343delCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTC	p.Pro433_Ser448del	disruptive_inframe_deletion	Exon 10 of 14	ENSP00000355296.3	O75112-1
	LDB3	ENST00000945680.1		c.1500_1547delCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTC	p.Pro501_Ser516del	disruptive_inframe_deletion	Exon 10 of 14	ENSP00000615739.1
	LDB3	ENST00000871464.1		c.1437_1484delCCCTGCCCCTGCCTACACCCCCTCCCCTGCCCCTGCCTACACCCCCTC	p.Pro480_Ser495del	disruptive_inframe_deletion	Exon 11 of 15	ENSP00000541523.1

Frequencies

GnomAD3 genomes AF: 0.00000667 AC: 1 AN: 149866 Hom.: 0 Cov.: 26

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000148

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000816 AC: 20 AN: 244960 AF XY: 0.0000601

Gnomad AFR exome AF: 0.000126

Gnomad AMR exome AF: 0.0000292

Gnomad ASJ exome AF: 0.000101

Gnomad EAS exome AF: 0.0000549

Gnomad FIN exome AF: 0.000140

Gnomad NFE exome AF: 0.0000826

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000302 AC: 44 AN: 1458114 Hom.: 0 AF XY: 0.0000331 AC XY: 24 AN XY: 725222

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.0000300 AC: 1 AN: 33360

American (AMR) AF: 0.0000897 AC: 4 AN: 44594

Ashkenazi Jewish (ASJ) AF: 0.000115 AC: 3 AN: 26066

East Asian (EAS) AF: 0.00 AC: 0 AN: 39664

South Asian (SAS) AF: 0.0000814 AC: 7 AN: 85976

European-Finnish (FIN) AF: 0.0000565 AC: 3 AN: 53096

Middle Eastern (MID) AF: 0.000242 AC: 1 AN: 4132

European-Non Finnish (NFE) AF: 0.0000216 AC: 24 AN: 1111062

Other (OTH) AF: 0.0000166 AC: 1 AN: 60164

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome AF: 0.00000667 AC: 1 AN: 149866 Hom.: 0 Cov.: 26 AF XY: 0.0000137 AC XY: 1 AN XY: 73046

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 40544

American (AMR) AF: 0.00 AC: 0 AN: 15020

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3430

East Asian (EAS) AF: 0.00 AC: 0 AN: 5076

South Asian (SAS) AF: 0.00 AC: 0 AN: 4628

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 10466

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.0000148 AC: 1 AN: 67426

Other (OTH) AF: 0.00 AC: 0 AN: 2056

⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5. (p-value = 0), which strongly suggests a high chance of mosaicism in these individuals.

ClinVar

ClinVar submissions

Significance: Benign

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
-	-	2	not specified (2)
-	-	1	Cardiomyopathy (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.4
Mutation Taster		=93/107	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397517209; hg19: chr10-88476134; COSMIC: COSV108798257; COSMIC: COSV108798257;