chr11-1017608-ACTGGTGGTCACTGTCATTGGTGG-A
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_005961.3(MUC6):c.5170_5192delCCACCAATGACAGTGACCACCAG(p.Pro1724TrpfsTer10) variant causes a frameshift change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_005961.3 frameshift
Scores
Clinical Significance
Conservation
Publications
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_005961.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MUC6 | NM_005961.3 | MANE Select | c.5170_5192delCCACCAATGACAGTGACCACCAG | p.Pro1724TrpfsTer10 | frameshift | Exon 31 of 33 | NP_005952.2 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MUC6 | ENST00000421673.7 | TSL:5 MANE Select | c.5170_5192delCCACCAATGACAGTGACCACCAG | p.Pro1724TrpfsTer10 | frameshift | Exon 31 of 33 | ENSP00000406861.2 | Q6W4X9 |
Frequencies
GnomAD3 genomes AF: 0.00101 AC: 59AN: 58646Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000363 AC: 44AN: 1210972Hom.: 0 AF XY: 0.0000448 AC XY: 27AN XY: 602306 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome Data not reliable, filtered out with message: AS_VQSR AF: 0.00101 AC: 59AN: 58704Hom.: 0 Cov.: 0 AF XY: 0.000893 AC XY: 26AN XY: 29114 show subpopulations ⚠️ The allele balance in gnomAD version 4 Genomes is significantly skewed from the expected value of 0.5.
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at