chr11-119092416-GTGGAAGTGCGAGCCAAGGACCAGGACATCT-G

Variant names:

• chr11-119092416-GTGGAAGTGCGAGCCAAGGACCAGGACATCT-G
• rs1555206128
• NM_000190.4:c.669_698delAGTGCGAGCCAAGGACCAGGACATCTTGGA

Variant summary

Our verdict is Likely pathogenic. The variant received 7 ACMG points: 7P and 0B. PM1 PM4 PP3 PP5_Moderate

The NM_000190.4(HMBS):​c.669_698delAGTGCGAGCCAAGGACCAGGACATCTTGGA​(p.Glu223_Leu232del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: HMBS NM_000190.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.73
• Publications: 2 publications found

Genes affected

HMBS (HGNC:4982): (hydroxymethylbilane synthase) This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

HMBS Gene-Disease associations (from GenCC):

• acute intermittent porphyria

  Inheritance: SD, AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 7 ACMG points.

• PM1: In a hotspot region, there are 6 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 0 benign, 16 uncertain in NM_000190.4
• PM4: Nonframeshift variant in NON repetitive region in NM_000190.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 11-119092416-GTGGAAGTGCGAGCCAAGGACCAGGACATCT-G is Pathogenic according to our data. Variant chr11-119092416-GTGGAAGTGCGAGCCAAGGACCAGGACATCT-G is described in ClinVar as Pathogenic. ClinVar VariationId is 522578.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HMBS	NM_000190.4	c.669_698delAGTGCGAGCCAAGGACCAGGACATCTTGGA	p.Glu223_Leu232del	disruptive_inframe_deletion	Exon 11 of 14	ENST00000652429.1	NP_000181.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HMBS	ENST00000652429.1	c.669_698delAGTGCGAGCCAAGGACCAGGACATCTTGGA	p.Glu223_Leu232del	disruptive_inframe_deletion	Exon 11 of 14		NM_000190.4	ENSP00000498786.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Acute intermittent porphyria Pathogenic:1

Medical Genetics, Hospital Clinico Universitario Virgen de la Arrixaca

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.7
Mutation Taster		=4/196	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555206128; hg19: chr11-118963126;