rs1555206128

Positions:

• chr11-119092416-GTGGAAGTGCGAGCCAAGGACCAGGACATCT-G

Variant summary

Our verdict is Likely pathogenic. Variant got 9 ACMG points: 9P and 0B. PM1 PM2 PM4 PP3 PP5_Moderate

The NM_000190.4(HMBS):​c.669_698delAGTGCGAGCCAAGGACCAGGACATCTTGGA​(p.Glu223_Leu232del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: HMBS NM_000190.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 9.73

Genes affected

HMBS (HGNC:4982): (hydroxymethylbilane synthase) This gene encodes a member of the hydroxymethylbilane synthase superfamily. The encoded protein is the third enzyme of the heme biosynthetic pathway and catalyzes the head to tail condensation of four porphobilinogen molecules into the linear hydroxymethylbilane. Mutations in this gene are associated with the autosomal dominant disease acute intermittent porphyria. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_pathogenic. Variant got 9 ACMG points.

• PM1: In a strand (size 5) in uniprot entity HEM3_HUMAN there are 4 pathogenic changes around while only 0 benign (100%) in NM_000190.4
• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_000190.4.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 11-119092416-GTGGAAGTGCGAGCCAAGGACCAGGACATCT-G is Pathogenic according to our data. Variant chr11-119092416-GTGGAAGTGCGAGCCAAGGACCAGGACATCT-G is described in ClinVar as [Pathogenic]. Clinvar id is 522578.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
HMBS	NM_000190.4	c.669_698delAGTGCGAGCCAAGGACCAGGACATCTTGGA	p.Glu223_Leu232del	disruptive_inframe_deletion	11/14	ENST00000652429.1	NP_000181.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
HMBS	ENST00000652429.1	c.669_698delAGTGCGAGCCAAGGACCAGGACATCTTGGA	p.Glu223_Leu232del	disruptive_inframe_deletion	11/14		NM_000190.4	ENSP00000498786.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Acute intermittent porphyria Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Medical Genetics, Hospital Clinico Universitario Virgen de la Arrixaca

-

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555206128; hg19: chr11-118963126;