chr11-2001762-TTTAGCATCTCAAGCTCCTAAA-T

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.

The NM_001400176.1(MRPL23):​c.498-9766_498-9746delGCTCCTAAATTAGCATCTCAA variant causes a intron change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as not provided (no stars).

Frequency

Genomes: not found (cov: 0)

Consequence

MRPL23
NM_001400176.1 intron

Scores

Not classified

Clinical Significance

not provided no classification provided O:1

Conservation

PhyloP100: 2.07
Variant links:
Genes affected
MRPL23 (HGNC:10322): (mitochondrial ribosomal protein L23) Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. The gene is biallelically expressed, despite its location within a region of imprinted genes on chromosome 11. [provided by RefSeq, Jul 2008]
H19 (HGNC:4713): (H19 imprinted maternally expressed transcript) This gene is located in an imprinted region of chromosome 11 near the insulin-like growth factor 2 (IGF2) gene. This gene is only expressed from the maternally-inherited chromosome, whereas IGF2 is only expressed from the paternally-inherited chromosome. The product of this gene is a long non-coding RNA which functions as a tumor suppressor. Mutations in this gene have been associated with Beckwith-Wiedemann Syndrome and Wilms tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 0 ACMG points.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MRPL23NM_001400176.1 linkc.498-9766_498-9746delGCTCCTAAATTAGCATCTCAA intron_variant Intron 5 of 6 NP_001387105.1
MRPL23XM_011520273.2 linkc.498-9766_498-9746delGCTCCTAAATTAGCATCTCAA intron_variant Intron 5 of 6 XP_011518575.1

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
H19ENST00000710497.1 linkn.116+2654_116+2674delTTTAGGAGCTTGAGATGCTAA intron_variant Intron 1 of 4
H19ENST00000428066.8 linkn.-77_-57delTTTAGGAGCTTGAGATGCTAA upstream_gene_variant 3
H19ENST00000431095.8 linkn.-77_-57delTTTAGGAGCTTGAGATGCTAA upstream_gene_variant 5

Frequencies

GnomAD3 genomes
Cov.:
0
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
0

ClinVar

Significance: not provided
Submissions summary: Other:1
Revision: no classification provided
LINK: link

Submissions by phenotype

Beckwith-Wiedemann syndrome Other:1
-
UMR_S938_Pr. Le Bouc INSERM
Significance: not provided
Review Status: no classification provided
Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs431825165; hg19: chr11-2022992; API