rs431825165

Variant names:

• chr11-2001762-TTTAGCATCTCAAGCTCCTAAA-T
• rs431825165
• NM_001400176.1:c.498-9766_498-9746delGCTCCTAAATTAGCATCTCAA

Variant summary

Our verdict is Uncertain significance. Variant got 0 ACMG points: 0P and 0B.

The NM_001400176.1(MRPL23):​c.498-9766_498-9746delGCTCCTAAATTAGCATCTCAA variant causes a intron change involving the alteration of a non-conserved nucleotide. Variant has been reported in ClinVar as not provided (no stars).

• Frequency: Genomes: not found (cov: 0)
• Consequence: MRPL23 NM_001400176.1 intron
• Clinical Significance: not provided no classification provided O:1
• Conservation: PhyloP100: 2.07

Genes affected

MRPL23 (HGNC:10322): (mitochondrial ribosomal protein L23) Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. The gene is biallelically expressed, despite its location within a region of imprinted genes on chromosome 11. [provided by RefSeq, Jul 2008]

H19 (HGNC:4713): (H19 imprinted maternally expressed transcript) This gene is located in an imprinted region of chromosome 11 near the insulin-like growth factor 2 (IGF2) gene. This gene is only expressed from the maternally-inherited chromosome, whereas IGF2 is only expressed from the paternally-inherited chromosome. The product of this gene is a long non-coding RNA which functions as a tumor suppressor. Mutations in this gene have been associated with Beckwith-Wiedemann Syndrome and Wilms tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

ACMG classification

Verdict is Uncertain_significance. Variant got 0 ACMG points.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MRPL23	NM_001400176.1	c.498-9766_498-9746delGCTCCTAAATTAGCATCTCAA		intron_variant	Intron 5 of 6		NP_001387105.1
MRPL23	XM_011520273.2	c.498-9766_498-9746delGCTCCTAAATTAGCATCTCAA		intron_variant	Intron 5 of 6		XP_011518575.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
H19	ENST00000710497.1	n.116+2654_116+2674delTTTAGGAGCTTGAGATGCTAA		intron_variant	Intron 1 of 4
H19	ENST00000428066.8	n.-77_-57delTTTAGGAGCTTGAGATGCTAA		upstream_gene_variant		3
H19	ENST00000431095.8	n.-77_-57delTTTAGGAGCTTGAGATGCTAA		upstream_gene_variant		5

Frequencies

GnomAD3 genomes Cov.: 0

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 0

ClinVar

Significance: not provided

Submissions summary: Other:1

Revision: no classification provided

Submissions by phenotype

Beckwith-Wiedemann syndrome Other:1

-

UMR_S938_Pr. Le Bouc INSERM

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs431825165; hg19: chr11-2022992;