chr11-47342804-CCATGCCCCGTGCTTCTGGAA-C
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_000256.3(MYBPC3):c.1457+6_1457+25delTTCCAGAAGCACGGGGCATG variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_000256.3 splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- hypertrophic cardiomyopathyInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- hypertrophic cardiomyopathy 4Inheritance: AD, AR Classification: DEFINITIVE, STRONG Submitted by: Ambry Genetics, G2P, Labcorp Genetics (formerly Invitae)
- left ventricular noncompaction 10Inheritance: AR, AD Classification: DEFINITIVE, MODERATE, LIMITED Submitted by: Ambry Genetics
- familial isolated dilated cardiomyopathyInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- arrhythmogenic right ventricular cardiomyopathyInheritance: AD Classification: LIMITED Submitted by: ClinGen
- atrial fibrillationInheritance: AD Classification: LIMITED Submitted by: Ambry Genetics
- dilated cardiomyopathyInheritance: AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000256.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MYBPC3 | NM_000256.3 | MANE Select | c.1457+6_1457+25delTTCCAGAAGCACGGGGCATG | splice_region intron | N/A | NP_000247.2 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| MYBPC3 | ENST00000545968.6 | TSL:5 MANE Select | c.1457+6_1457+25delTTCCAGAAGCACGGGGCATG | splice_region intron | N/A | ENSP00000442795.1 | |||
| MYBPC3 | ENST00000399249.6 | TSL:5 | c.1457+6_1457+25delTTCCAGAAGCACGGGGCATG | splice_region intron | N/A | ENSP00000382193.2 | |||
| MYBPC3 | ENST00000544791.1 | TSL:5 | n.1457+6_1457+25delTTCCAGAAGCACGGGGCATG | splice_region intron | N/A | ENSP00000444259.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
not specified Uncertain:1
Variant classified as Uncertain Significance - Favor Pathogenic. The 1457+6_1457 +25del variant in MYBPC3 has not been previously reported in the literature, but has been detected in 1 individual with HCM out of > 3300 probands (>2000 Caucas ian) tested by our laboratory and segregated with disease in four family members (including 1 obligate carrier). This variant is located in the 5' splice region and computational tools do not predict altered splicing. However, this informat ion is not predictive enough to rule out pathogenicity. While the low frequency of this variant and the segregation with disease favors a pathogenic role, we ca nnot rule out that this variant may be benign. Additional segregation studies an d functional analyses are needed to fully assess the clinical significance of th is variant.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at