rs727503201

Variant names:

• chr11-47342804-CCATGCCCCGTGCTTCTGGAA-C
• rs727503201
• NM_000256.3:c.1457+6_1457+25delTTCCAGAAGCACGGGGCATG

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_000256.3(MYBPC3):​c.1457+6_1457+25delTTCCAGAAGCACGGGGCATG variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: MYBPC3 NM_000256.3 splice_region, intron
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: 1.20

Genes affected

MYBPC3 (HGNC:7551): (myosin binding protein C3) MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]

ACMG classification

Verdict is Uncertain_significance. Variant got 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
MYBPC3	NM_000256.3	c.1457+6_1457+25delTTCCAGAAGCACGGGGCATG		splice_region_variant, intron_variant	Intron 16 of 34	ENST00000545968.6	NP_000247.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
MYBPC3	ENST00000545968.6	c.1457+6_1457+25delTTCCAGAAGCACGGGGCATG		splice_region_variant, intron_variant	Intron 16 of 34	5	NM_000256.3	ENSP00000442795.1
MYBPC3	ENST00000399249.6	c.1457+6_1457+25delTTCCAGAAGCACGGGGCATG		splice_region_variant, intron_variant	Intron 15 of 33	5		ENSP00000382193.2
MYBPC3	ENST00000544791.1	n.1457+6_1457+25delTTCCAGAAGCACGGGGCATG		splice_region_variant, intron_variant	Intron 16 of 26	5		ENSP00000444259.1

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

not specified Uncertain:1

Apr 19, 2012

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant classified as Uncertain Significance - Favor Pathogenic. The 1457+6_1457 +25del variant in MYBPC3 has not been previously reported in the literature, but has been detected in 1 individual with HCM out of > 3300 probands (>2000 Caucas ian) tested by our laboratory and segregated with disease in four family members (including 1 obligate carrier). This variant is located in the 5' splice region and computational tools do not predict altered splicing. However, this informat ion is not predictive enough to rule out pathogenicity. While the low frequency of this variant and the segregation with disease favors a pathogenic role, we ca nnot rule out that this variant may be benign. Additional segregation studies an d functional analyses are needed to fully assess the clinical significance of th is variant. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs727503201; hg19: chr11-47364355;