rs727503201

Variant summary

Our verdict is Uncertain significance. Variant got 2 ACMG points: 2P and 0B. PM2

The NM_000256.3(MYBPC3):​c.1457+6_1457+25delTTCCAGAAGCACGGGGCATG variant causes a splice region, intron change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

Frequency

Genomes: not found (cov: 33)

Consequence

MYBPC3
NM_000256.3 splice_region, intron

Scores

Not classified

Clinical Significance

Uncertain significance criteria provided, single submitter U:1

Conservation

PhyloP100: 1.20
Variant links:
Genes affected
MYBPC3 (HGNC:7551): (myosin binding protein C3) MYBPC3 encodes the cardiac isoform of myosin-binding protein C. Myosin-binding protein C is a myosin-associated protein found in the cross-bridge-bearing zone (C region) of A bands in striated muscle. MYBPC3 is expressed exclusively in heart muscle and is a key regulator of cardiac contraction. Mutations in this gene are a frequent cause of familial hypertrophic cardiomyopathy. [provided by RefSeq, May 2022]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Uncertain_significance. Variant got 2 ACMG points.

PM2
Very rare variant in population databases, with high coverage;

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
MYBPC3NM_000256.3 linkc.1457+6_1457+25delTTCCAGAAGCACGGGGCATG splice_region_variant, intron_variant Intron 16 of 34 ENST00000545968.6 NP_000247.2 Q14896-1A5YM48

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
MYBPC3ENST00000545968.6 linkc.1457+6_1457+25delTTCCAGAAGCACGGGGCATG splice_region_variant, intron_variant Intron 16 of 34 5 NM_000256.3 ENSP00000442795.1 Q14896-1
MYBPC3ENST00000399249.6 linkc.1457+6_1457+25delTTCCAGAAGCACGGGGCATG splice_region_variant, intron_variant Intron 15 of 33 5 ENSP00000382193.2 A8MXZ9
MYBPC3ENST00000544791.1 linkn.1457+6_1457+25delTTCCAGAAGCACGGGGCATG splice_region_variant, intron_variant Intron 16 of 26 5 ENSP00000444259.1 F5GZR4

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Uncertain significance
Submissions summary: Uncertain:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

not specified Uncertain:1
Apr 19, 2012
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Significance: Uncertain significance
Review Status: criteria provided, single submitter
Collection Method: clinical testing

Variant classified as Uncertain Significance - Favor Pathogenic. The 1457+6_1457 +25del variant in MYBPC3 has not been previously reported in the literature, but has been detected in 1 individual with HCM out of > 3300 probands (>2000 Caucas ian) tested by our laboratory and segregated with disease in four family members (including 1 obligate carrier). This variant is located in the 5' splice region and computational tools do not predict altered splicing. However, this informat ion is not predictive enough to rule out pathogenicity. While the low frequency of this variant and the segregation with disease favors a pathogenic role, we ca nnot rule out that this variant may be benign. Additional segregation studies an d functional analyses are needed to fully assess the clinical significance of th is variant. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs727503201; hg19: chr11-47364355; API