chr11-5226795-GCAGCCTAAGGGTGGGAAAATAGACC-G

Variant summary

Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate

The NM_000518.5(HBB):​c.93-21_96delGGTCTATTTTCCCACCCTTAGGCTG​(p.Arg31fs) variant causes a frameshift, splice acceptor, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. R31R) has been classified as Pathogenic.

Frequency

Genomes: not found (cov: 32)

Consequence

HBB
NM_000518.5 frameshift, splice_acceptor, splice_region, intron

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:2

Conservation

PhyloP100: 7.47
Variant links:
Genes affected
HBB (HGNC:4827): (hemoglobin subunit beta) The alpha (HBA) and beta (HBB) loci determine the structure of the 2 types of polypeptide chains in adult hemoglobin, Hb A. The normal adult hemoglobin tetramer consists of two alpha chains and two beta chains. Mutant beta globin causes sickle cell anemia. Absence of beta chain causes beta-zero-thalassemia. Reduced amounts of detectable beta globin causes beta-plus-thalassemia. The order of the genes in the beta-globin cluster is 5'-epsilon -- gamma-G -- gamma-A -- delta -- beta--3'. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 12 ACMG points.

PVS1
Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most 50 bp of the penultimate exon, not predicted to undergo nonsense mediated mRNA decay. There are 130 pathogenic variants in the truncated region.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 11-5226795-GCAGCCTAAGGGTGGGAAAATAGACC-G is Pathogenic according to our data. Variant chr11-5226795-GCAGCCTAAGGGTGGGAAAATAGACC-G is described in ClinVar as [Pathogenic]. Clinvar id is 632854.Status of the report is criteria_provided_single_submitter, 1 stars. Variant chr11-5226795-GCAGCCTAAGGGTGGGAAAATAGACC-G is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
HBBNM_000518.5 linkc.93-21_96delGGTCTATTTTCCCACCCTTAGGCTG p.Arg31fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 2 of 3 ENST00000335295.4 NP_000509.1 P68871D9YZU5

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
HBBENST00000335295.4 linkc.93-21_96delGGTCTATTTTCCCACCCTTAGGCTG p.Arg31fs frameshift_variant, splice_acceptor_variant, splice_region_variant, intron_variant Exon 2 of 3 1 NM_000518.5 ENSP00000333994.3 P68871

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

beta Thalassemia Pathogenic:2
Nov 25, 2019
The ITHANET community portal, The Cyprus Institute of Neurology and Genetics
Significance: Pathogenic
Review Status: no assertion criteria provided
Collection Method: curation

- -

Jul 25, 2019
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

Variant summary: HBB c.93-21_96del25 is located in a canonical splice-site and is predicted to affect mRNA splicing resulting in a significantly altered protein due to either exon skipping, shortening, or inclusion of intronic material. Several computational tools predict a significant impact on normal splicing: five predict the variant abolishes a 3 prime acceptor site. A slightly different variant affecting the same region (c.93-22_95del25) was confirmed by a functional study to affect splicing (Orkin_1983), providing supporting evidence for a pathogenic role of c.93-21_96del25. This variant was absent in 251348 control chromosomes (gnomAD). c.93-21_96del25 has been reported in the literature in individuals affected with Beta Thalassemia (Hassan_2014, Aldakeel_2019). These data indicate that the variant may be associated with disease. No other clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014. Based on the evidence outlined above, the variant was classified as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs63750223; hg19: chr11-5248025; API