chr11-5227161-G-C

Variant names:

• chr11-5227161-G-C
• rs34999973
• ENST00000647020.1:c.-140C>G

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 3P and 1B. PM2 PP5 BP4

The ENST00000647020.1(HBB):​c.-140C>G variant causes a 5 prime UTR change. The variant was absent in control chromosomes in GnomAD project. In-silico tool predicts a benign outcome for this variant. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency: Genomes: not found (cov: 33)
• Consequence: HBB ENST00000647020.1 5_prime_UTR
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:4 U:2
• Conservation: PhyloP100: 3.60
• Publications: 16 publications found

Genes affected

HBB (HGNC:4827): (hemoglobin subunit beta) The alpha (HBA) and beta (HBB) loci determine the structure of the 2 types of polypeptide chains in adult hemoglobin, Hb A. The normal adult hemoglobin tetramer consists of two alpha chains and two beta chains. Mutant beta globin causes sickle cell anemia. Absence of beta chain causes beta-zero-thalassemia. Reduced amounts of detectable beta globin causes beta-plus-thalassemia. The order of the genes in the beta-globin cluster is 5'-epsilon -- gamma-G -- gamma-A -- delta -- beta--3'. [provided by RefSeq, Jul 2008]

HBB Gene-Disease associations (from GenCC):

• dominant beta-thalassemia

  Inheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), ClinGen
• hemoglobin M disease

  Inheritance: AD Classification: DEFINITIVE, MODERATE, SUPPORTIVE Submitted by: Orphanet, Ambry Genetics, ClinGen
• beta thalassemia

  Inheritance: AR Classification: DEFINITIVE Submitted by: Myriad Women’s Health
• beta-thalassemia HBB/LCRB

  Inheritance: AR, SD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), ClinGen, Ambry Genetics
• sickle cell disease and related diseases

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• erythrocytosis, familial, 6

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• Heinz body anemia

  Inheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• sickle cell disease

  Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
• hereditary persistence of fetal hemoglobin-beta-thalassemia syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• beta-thalassemia intermedia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• beta-thalassemia major

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• delta-beta-thalassemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hemoglobin C disease

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hemoglobin C-beta-thalassemia syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hemoglobin E disease

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hemoglobin E-beta-thalassemia syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• hereditary persistence of fetal hemoglobin-sickle cell disease syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• sickle cell-beta-thalassemia disease syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• sickle cell-hemoglobin c disease syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• sickle cell-hemoglobin d disease syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• sickle cell-hemoglobin E disease syndrome

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000298932 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 11-5227161-G-C is Pathogenic according to our data. Variant chr11-5227161-G-C is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 495975.
• BP4: Computational evidence support a benign effect (BayesDel_noAF=-0.4). . Strength limited to SUPPORTING due to the PP5.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
HBB	NM_000518.5	c.-140C>G		upstream_gene_variant		ENST00000335295.4	NP_000509.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
HBB	ENST00000335295.4	c.-140C>G		upstream_gene_variant		1	NM_000518.5	ENSP00000333994.3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome Cov.: 5

GnomAD4 genome Cov.: 33

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:4 Uncertain:2

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Pathogenic:2

Oct 12, 2023

Quest Diagnostics Nichols Institute San Juan Capistrano

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The HBB c.-140C>G variant (also known -90C>G) variant is located in the promoter region of the HBB gene and has been reported in the published literature in an individual with beta(+) thalassemia (PMID: 28603845 (2017)). This variant reduces the binding of transcription factors and causes decreased transcription of the beta-globin gene (ITHANET (http://www.ithanet.eu/)). This variant has not been reported in large, multi-ethnic general populations (Genome Aggregation Database, http://gnomad.broadinstitute.org). Based on the available information, this variant is classified as pathogenic. -

Jun 10, 2024

ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The HBB c.-140C>G variant, also known as c.-90C>G, has been reported in the heterozygous state in a family with beta thalassemia trait and segregated with microcytic anemia, hypochromia and elevated HbA2 levels (Rizo-de-la-Torre 2017). This variant is absent from the Genome Aggregation Database (v2.1.1), indicating it is not a common polymorphism. The c.-140C>G variant occurs in a conserved proximal CACCC element necessary for efficient HBB gene expression, and variants affecting this consensus sequence are associated with a beta+ thalassemia phenotype (Faustino 1996, Kulozik 1991, Rizo-de-la-Torre 2017). Another variant at the same position (c.-140C>T) has been described in multiple individuals with beta thalassemia and is considered disease-causing (Jia 2003, Shaji 2002). Based on available information, the c.-140C>G variant is considered to be likely pathogenic. References: Jia S et al. A rare beta-thalassaemia mutation (C-T) at position -90 of the beta-globin gene discovered in a Chinese family. Haematologica. 2003;88(10):1191-3. PMID: 14555318. Faustino P et al. beta-Thalassemia mutation at -90C-->T impairs the interaction of the proximal CACCC box with both erythroid and nonerythroid factors. Blood. 1996;88(8):3248-9. PMID: 8874232. Kulozik A et al. Thalassemia intermedia: moderate reduction of beta globin gene transcriptional activity by a novel mutation of the proximal CACCC promoter element. Blood. 1991 May 1;77(9):2054-8. Rizo-de-la-Torre L et al. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of beta-Thalassemia in Mexican mestizo patients. Int J Lab Hematol. 2017 Oct;39(5):539-545. PMID: 28603845. Shaji RV et al. Rapid detection of beta-globin gene mutations and polymorphisms by temporal temperature gradient gel electrophoresis. Clin Chem. 2003;49(5):777-81. PMID: 12709369. -

beta Thalassemia Pathogenic:1 Uncertain:1

Nov 25, 2019

The ITHANET community portal, The Cyprus Institute of Neurology and Genetics

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: curation

- -

Aug 19, 2021

Natera, Inc.

Significance: Uncertain significance

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Hb SS disease;C0019025:Hereditary persistence of fetal hemoglobin;C0700299:Heinz body anemia;C1840779:METHEMOGLOBINEMIA, BETA TYPE;C1858990:Dominant beta-thalassemia;C1970028:Malaria, susceptibility to;C4693822:Erythrocytosis, familial, 6;CN322236:Beta-thalassemia HBB/LCRB Pathogenic:1

Mar 24, 2024

Fulgent Genetics, Fulgent Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

not specified Uncertain:1

Mar 21, 2024

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: HBB c.-140C>G variant leads to a substitution in the 5' UTR conserved promoter sequence (CACCC box) at a conserved nucleotide. The transcription factor erythroid Kruppel-like factor (EKLF) specifically activates the b-globin gene by interacting with the proximal b-globin CACCC box, a known hot spot for thalassaemia mutations. It has been shown that EKLF requires both the proximal and distal CACCC boxes to maximally stimulate the b-globin gene, and thus changes to the CACCC boxes are expected to reduce HBB expression (PMID:15384985). Consensus agreement among computation tools predict no significant impact on normal splicing. However, these predictions have yet to be confirmed by functional studies. The variant was absent in 31402 control chromosomes (gnomAD). c.-140C>G has been reported in the literature in at least 4 heterozygous carrier members of a family, with the proband being reported with anemia, microcytosis, hypochromia and elevated HbA2 (e.g. Rizo-de la Torre_2017). The variant is reported in the Ithanet database as "globin gene causative mutation". Another substitution at the same position, c.-140C>T has been classified as a pathogenic variant by our laboratory and it is reported to impair mRNA synthesis (PMIDs: 3457470 and 14555318). Furthermore, other substitutions in the same CACCC box have been classified as pathogenic by our laboratory (e.g. c.-138C>T, c.-138C>A, c.-137C>G, c.-137C>T, c.-136C>G). To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publications have been ascertained in the context of this evaluation (PMID: 28603845, 33734896). ClinVar contains an entry for this variant (Variation ID: 495975). Based on the evidence outlined above, the variant was classified as VUS-possibly pathogenic. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
BayesDel_noAF	Benign	-0.40
CADD	Benign	16
DANN	Benign	0.72
PhyloP100		3.6
PromoterAI		-0.23	Neutral
Mutation Taster		=39/61	disease causing

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs34999973; hg19: chr11-5248391;