chr11-66070573-T-TCAGCAGCCGCCGCCGCAGCAGCAGCAG

Variant names:

• chr11-66070573-T-TCAGCAGCCGCCGCCGCAGCAGCAGCAG
• rs1438611816
• NM_018026.4:c.101_127dupCGCAGCAGCAGCAGCAGCAGCCGCCGC

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 0P and 4B. BS2

The NM_018026.4(PACS1):​c.101_127dupCGCAGCAGCAGCAGCAGCAGCCGCCGC​(p.Pro34_Pro42dup) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000484 in 1,486,668 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000052 (0 hom.)
• Consequence: PACS1 NM_018026.4 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 1.85

Genes affected

PACS1 (HGNC:30032): (phosphofurin acidic cluster sorting protein 1) This gene encodes a protein with a putative role in the localization of trans-Golgi network (TGN) membrane proteins. Mouse and rat homologs have been identified and studies of the homologous rat protein indicate a role in directing TGN localization of furin by binding to the protease's phosphorylated cytosolic domain. In addition, the human protein plays a role in HIV-1 Nef-mediated downregulation of cell surface MHC-I molecules to the TGN, thereby enabling HIV-1 to escape immune surveillance. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• BS2: High AC in GnomAdExome4 at 69 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PACS1	NM_018026.4	c.101_127dupCGCAGCAGCAGCAGCAGCAGCCGCCGC	p.Pro34_Pro42dup	disruptive_inframe_insertion	Exon 1 of 24	ENST00000320580.9	NP_060496.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PACS1	ENST00000320580.9	c.101_127dupCGCAGCAGCAGCAGCAGCAGCCGCCGC	p.Pro34_Pro42dup	disruptive_inframe_insertion	Exon 1 of 24	1	NM_018026.4	ENSP00000316454.4
PACS1	ENST00000527224.1	n.225_251dupCGCAGCAGCAGCAGCAGCAGCCGCCGC		non_coding_transcript_exon_variant	Exon 1 of 7	2

Frequencies

GnomAD3 genomes AF: 0.0000199 AC: 3 AN: 151032 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.0000243

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000296

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000223 AC: 2 AN: 89510 Hom.: 0 AF XY: 0.0000394 AC XY: 2 AN XY: 50754

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000615

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000517 AC: 69 AN: 1335636 Hom.: 0 Cov.: 31 AF XY: 0.0000516 AC XY: 34 AN XY: 658802

Gnomad4 AFR exome AF: 0.000185

Gnomad4 AMR exome AF: 0.0000328

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.0000134

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000539

Gnomad4 OTH exome AF: 0.0000720

GnomAD4 genome AF: 0.0000199 AC: 3 AN: 151032 Hom.: 0 Cov.: 32 AF XY: 0.0000136 AC XY: 1 AN XY: 73754

Gnomad4 AFR AF: 0.0000243

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000296

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1438611816; hg19: chr11-65838044;