chr11-67490802-T-TACTTCAAGCGGGGCAAGGCCC

Variant names:

• chr11-67490802-T-TACTTCAAGCGGGGCAAGGCCC
• rs267606578
• NM_003977.4:c.805_825dupTTCAAGCGGGGCAAGGCCCAC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 14P and 4B. PS3 PM4 PP5_Very_Strong BS2

The NM_003977.4(AIP):​c.805_825dupTTCAAGCGGGGCAAGGCCCAC​(p.Phe269_His275dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000616 in 1,459,936 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). ClinVar reports functional evidence for this variant: "SCV001189617: "In addition, co-immunoprecipitation with this AIP mutant and HSP90 showed lack of interaction between these two proteins, resulting in reduced protein stability (Salvatori R. et al. Eur. J. Endocrinol. 2017 Sep" and additional evidence is available in ClinVar. Synonymous variant affecting the same amino acid position (i.e. A276A) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000062 (0 hom.)
• Consequence: AIP NM_003977.4 conservative_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2 O:1
• Conservation: PhyloP100: 2.19
• Publications: 4 publications found

Genes affected

AIP (HGNC:358): (aryl hydrocarbon receptor interacting protein) The protein encoded by this gene is a receptor for aryl hydrocarbons and a ligand-activated transcription factor. The encoded protein is found in the cytoplasm as part of a multiprotein complex, but upon binding of ligand is transported to the nucleus. This protein can regulate the expression of many xenobiotic metabolizing enzymes. Also, the encoded protein can bind specifically to and inhibit the activity of hepatitis B virus. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]

AIP Gene-Disease associations (from GenCC):

• growth hormone secreting pituitary adenoma 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• familial isolated pituitary adenoma

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• pituitary gigantism

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• acromegaly

  Inheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PS3: PS3 evidence extracted from ClinVar submissions: SCV001189617: "In addition, co-immunoprecipitation with this AIP mutant and HSP90 showed lack of interaction between these two proteins, resulting in reduced protein stability (Salvatori R. et al. Eur. J. Endocrinol. 2017 Sep;177(3):257-266)."; SCV001586343: Experimental studies have shown that this variant affects AIP function (PMID: 28634279).
• PM4: Nonframeshift variant in NON repetitive region in NM_003977.4.
• PP5: Variant 11-67490802-T-TACTTCAAGCGGGGCAAGGCCC is Pathogenic according to our data. Variant chr11-67490802-T-TACTTCAAGCGGGGCAAGGCCC is described in ClinVar as Pathogenic. ClinVar VariationId is 41208.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High AC in GnomAdExome4 at 9 AD,Unknown gene.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_003977.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AIP	NM_003977.4	MANE Select	c.805_825dupTTCAAGCGGGGCAAGGCCCAC	p.Phe269_His275dup	conservative_inframe_insertion	Exon 6 of 6	NP_003968.3	O00170
	AIP	NM_001302959.2		c.628_648dupTTCAAGCGGGGCAAGGCCCAC	p.Phe210_His216dup	conservative_inframe_insertion	Exon 6 of 6	NP_001289888.1	A0A804HKL7
	AIP	NM_001302960.2		c.797_817dupTTCAAGCGGGGCAAGGCCCAC	p.Leu266_Pro272dup	disruptive_inframe_insertion	Exon 6 of 6	NP_001289889.1	A0A804HJ38

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	AIP	ENST00000279146.8	TSL:1 MANE Select	c.805_825dupTTCAAGCGGGGCAAGGCCCAC	p.Phe269_His275dup	conservative_inframe_insertion	Exon 6 of 6	ENSP00000279146.3	O00170
	AIP	ENST00000934218.1		c.895_915dupTTCAAGCGGGGCAAGGCCCAC	p.Phe299_His305dup	conservative_inframe_insertion	Exon 6 of 6	ENSP00000604277.1
	AIP	ENST00000872352.1		c.799_819dupTTCAAGCGGGGCAAGGCCCAC	p.Phe267_His273dup	conservative_inframe_insertion	Exon 6 of 6	ENSP00000542411.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000616 AC: 9 AN: 1459936 Hom.: 0 Cov.: 32 AF XY: 0.00000413 AC XY: 3 AN XY: 726290

African (AFR) AF: 0.00 AC: 0 AN: 33448

American (AMR) AF: 0.00 AC: 0 AN: 44710

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26132

East Asian (EAS) AF: 0.00 AC: 0 AN: 39700

South Asian (SAS) AF: 0.00 AC: 0 AN: 86220

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 52226

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5264

European-Non Finnish (NFE) AF: 0.00000719 AC: 8 AN: 1111924

Other (OTH) AF: 0.0000166 AC: 1 AN: 60312

GnomAD4 genome Cov.: 33

Alfa AF: 0.0000936 Hom.: 0

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	-	-	Hereditary cancer-predisposing syndrome (1)
1	-	-	not provided (1)
-	-	-	Somatotroph adenoma (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.2
Mutation Taster		=44/56	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.

Other links and lift over

dbSNP: rs267606578;

hg19: chr11-67258273;