rs267606578
Variant summary
Our verdict is Likely pathogenic. The variant received 6 ACMG points: 10P and 4B. PM4PP5_Very_StrongBS2
The NM_003977.4(AIP):c.805_825dupTTCAAGCGGGGCAAGGCCCAC(p.Phe269_His275dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000616 in 1,459,936 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. A276A) has been classified as Likely benign.
Frequency
Consequence
NM_003977.4 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- growth hormone secreting pituitary adenoma 1Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- familial isolated pituitary adenomaInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- pituitary gigantismInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- acromegalyInheritance: Unknown Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 6 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_003977.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| AIP | NM_003977.4 | MANE Select | c.805_825dupTTCAAGCGGGGCAAGGCCCAC | p.Phe269_His275dup | conservative_inframe_insertion | Exon 6 of 6 | NP_003968.3 | ||
| AIP | NM_001302959.2 | c.628_648dupTTCAAGCGGGGCAAGGCCCAC | p.Phe210_His216dup | conservative_inframe_insertion | Exon 6 of 6 | NP_001289888.1 | |||
| AIP | NM_001302960.2 | c.797_817dupTTCAAGCGGGGCAAGGCCCAC | p.Leu266_Pro272dup | disruptive_inframe_insertion | Exon 6 of 6 | NP_001289889.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| AIP | ENST00000279146.8 | TSL:1 MANE Select | c.805_825dupTTCAAGCGGGGCAAGGCCCAC | p.Phe269_His275dup | conservative_inframe_insertion | Exon 6 of 6 | ENSP00000279146.3 | ||
| AIP | ENST00000934218.1 | c.895_915dupTTCAAGCGGGGCAAGGCCCAC | p.Phe299_His305dup | conservative_inframe_insertion | Exon 6 of 6 | ENSP00000604277.1 | |||
| AIP | ENST00000872352.1 | c.799_819dupTTCAAGCGGGGCAAGGCCCAC | p.Phe267_His273dup | conservative_inframe_insertion | Exon 6 of 6 | ENSP00000542411.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD4 exome AF: 0.00000616 AC: 9AN: 1459936Hom.: 0 Cov.: 32 AF XY: 0.00000413 AC XY: 3AN XY: 726290 show subpopulations
Age Distribution
GnomAD4 genome Cov.: 33
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at