rs267606578

Positions:

• chr11-67490802-T-TACTTCAAGCGGGGCAAGGCCC

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 10P and 4B. PM4 PP5_Very_Strong BS2

The NM_003977.4(AIP):​c.805_825dupTTCAAGCGGGGCAAGGCCCAC​(p.Phe269_His275dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000616 in 1,459,936 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 0.0000062 (0 hom.)
• Consequence: AIP NM_003977.4 conservative_inframe_insertion
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2 O:1
• Conservation: PhyloP100: 2.19

Genes affected

AIP (HGNC:358): (aryl hydrocarbon receptor interacting protein) The protein encoded by this gene is a receptor for aryl hydrocarbons and a ligand-activated transcription factor. The encoded protein is found in the cytoplasm as part of a multiprotein complex, but upon binding of ligand is transported to the nucleus. This protein can regulate the expression of many xenobiotic metabolizing enzymes. Also, the encoded protein can bind specifically to and inhibit the activity of hepatitis B virus. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_003977.4.
• PP5: Variant 11-67490802-T-TACTTCAAGCGGGGCAAGGCCC is Pathogenic according to our data. Variant chr11-67490802-T-TACTTCAAGCGGGGCAAGGCCC is described in ClinVar as [Pathogenic]. Clinvar id is 41208.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
• BS2: High AC in GnomAdExome4 at 9 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
AIP	NM_003977.4	c.805_825dupTTCAAGCGGGGCAAGGCCCAC	p.Phe269_His275dup	conservative_inframe_insertion	6/6	ENST00000279146.8	NP_003968.3
AIP	NM_001302959.2	c.628_648dupTTCAAGCGGGGCAAGGCCCAC	p.Phe210_His216dup	conservative_inframe_insertion	6/6		NP_001289888.1
AIP	NM_001302960.2	c.797_817dupTTCAAGCGGGGCAAGGCCCAC	p.Leu266_Pro272dup	disruptive_inframe_insertion	6/6		NP_001289889.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
AIP	ENST00000279146.8	c.805_825dupTTCAAGCGGGGCAAGGCCCAC	p.Phe269_His275dup	conservative_inframe_insertion	6/6	1	NM_003977.4	ENSP00000279146.3

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD4 exome AF: 0.00000616 AC: 9 AN: 1459936 Hom.: 0 Cov.: 32 AF XY: 0.00000413 AC XY: 3 AN XY: 726290

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000719

Gnomad4 OTH exome AF: 0.0000166

GnomAD4 genome Cov.: 33

Alfa AF: 0.0000936 Hom.: 0

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2 Other:1

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Labcorp Genetics (formerly Invitae), Labcorp

Dec 18, 2023

This variant, c.805_825dup, results in the insertion of 7 amino acid(s) of the AIP protein (p.Phe269_His275dup), but otherwise preserves the integrity of the reading frame. This variant is not present in population databases (gnomAD no frequency). This variant has been observed in individual(s) with pituitary adenoma (PMID: 26186299, 28634279). It has also been observed to segregate with disease in related individuals. ClinVar contains an entry for this variant (Variation ID: 41208). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. Experimental studies have shown that this variant affects AIP function (PMID: 28634279). For these reasons, this variant has been classified as Pathogenic. -

Hereditary cancer-predisposing syndrome Pathogenic:1

Pathogenic, criteria provided, single submitter

clinical testing

Ambry Genetics

Oct 17, 2019

The c.805_825dup21 pathogenic mutation (also known as p.F269_H275dup), located in coding exon 6 of the AIP gene, results from an in-frame duplication of 21 nucleotides at nucleotide positions 805 to 825. This results in the duplication of 7 extra residues (FKRGKAH) between codons 269 and 275. This duplication has been reported in multiple individuals with familial isolated pituitary adenomas (FIPA) resulting in gigantism and/or acromegaly, although some carriers in these families remained unaffected (Leontiou CA et al. J. Clin. Endocrinol. Metab. 2008 Jun;93(6):2390-401; Igreja S. et al. Hum. Mutat. 2010 Aug;31(8):950-60; Salvatori R. et al. Eur. J. Endocrinol. 2017 Sep;177(3):257-266; Cazabat L et al. J. Clin Endocrinol. Metab. 2012 Apr;97(4):E663-70). One affected individual also developed a GIST (Hernandez-Ramire LC et al. J. Clin. Endocrinol. Metab. 2015 Sep;100(9):E1242-54). Authors of one study proposed replication slipage as the mechanism for this duplication and report this as an English founder mutation due to a shared haplotype around AIP in affected, unrelated individuals (Salvatori R. et al. Eur. J. Endocrinol. 2017 Sep;177(3):257-266). In addition, co-immunoprecipitation with this AIP mutant and HSP90 showed lack of interaction between these two proteins, resulting in reduced protein stability (Salvatori R. et al. Eur. J. Endocrinol. 2017 Sep;177(3):257-266). Furthermore, this variant was not reported in population-based cohorts in the Genome Aggregation Database (gnomAD). Of note, this mutation is also referred to as c.794_823dup (p.A247_H275ins10) in published literature. Based on the supporting evidence, this alteration is interpreted as a disease-causing mutation. -

Somatotroph adenoma Other:1

not provided, no classification provided

literature only

GeneReviews

-

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs267606578; hg19: chr11-67258273;