chr12-102894733-ACCTGTGTCTTTCTTCTTATCTCGTGAAAGCTCATGGACAGTGGCACCAATGTCATGCCTCAAGATCTTGATGATGTTTGTCAGAGCAGGCAGGCTACGTTTATCCAAATGGGTGAAAAATTCATACTCATCTTTCTTTAAACGAGAAGGTCTAGATTCAATGTGGGTCAGGTTTACATCATTCT-A
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_000277.3(PAH):c.170_352+1del(p.Glu57_Thr117del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_000277.3 splice_donor, disruptive_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- phenylketonuriaInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Myriad Women’s Health
- classic phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- maternal phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- mild hyperphenylalaninemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- mild phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- tetrahydrobiopterin-responsive hyperphenylalaninemia/phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000277.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PAH | NM_000277.3 | MANE Select | c.170_352+1del | p.Glu57_Thr117del | splice_donor disruptive_inframe_deletion splice_region intron | Exon 3 of 13 | NP_000268.1 | ||
| PAH | NM_001354304.2 | c.170_352+1del | p.Glu57_Thr117del | splice_donor disruptive_inframe_deletion splice_region intron | Exon 4 of 14 | NP_001341233.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PAH | ENST00000553106.6 | TSL:1 MANE Select | c.170_352+1del | p.Glu57_Thr117del | splice_donor disruptive_inframe_deletion splice_region intron | Exon 3 of 13 | ENSP00000448059.1 | ||
| PAH | ENST00000549111.5 | TSL:1 | n.266_448+1del | splice_donor splice_region intron non_coding_transcript_exon | Exon 3 of 6 | ||||
| PAH | ENST00000546844.1 | TSL:3 | c.170_*1del | p.Glu57_Thr117del | conservative_inframe_deletion splice_region | Exon 4 of 4 | ENSP00000446658.1 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at