chr12-102894733-ACCTGTGTCTTTCTTCTTATCTCGTGAAAGCTCATGGACAGTGGCACCAATGTCATGCCTCAAGATCTTGATGATGTTTGTCAGAGCAGGCAGGCTACGTTTATCCAAATGGGTGAAAAATTCATACTCATCTTTCTTTAAACGAGAAGGTCTAGATTCAATGTGGGTCAGGTTTACATCATTCT-A
Variant summary
Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1
The NM_000277.3(PAH):c.170_352+1del(p.Glu57_Thr117del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
NM_000277.3 splice_donor, disruptive_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Publications
- phenylketonuriaInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Myriad Women’s Health
- classic phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- maternal phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- mild hyperphenylalaninemiaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- mild phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
- tetrahydrobiopterin-responsive hyperphenylalaninemia/phenylketonuriaInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Likely_pathogenic. The variant received 8 ACMG points.
Transcripts
RefSeq
| Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|
| PAH | NM_000277.3 | c.170_352+1del | p.Glu57_Thr117del | splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant | Exon 3 of 13 | ENST00000553106.6 | NP_000268.1 | |
| PAH | NM_001354304.2 | c.170_352+1del | p.Glu57_Thr117del | splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant | Exon 4 of 14 | NP_001341233.1 | ||
| PAH | XM_017019370.2 | c.170_352+1del | p.Glu57_Thr117del | splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant | Exon 3 of 7 | XP_016874859.1 | ||
| LOC124902999 | XR_007063428.1 | n.863-9961_863-9778del | intron_variant | Intron 2 of 2 |
Ensembl
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at