rs199475570

Variant names:

• chr12-102894733-ACCTGTGTCTTTCTTCTTATCTCGTGAAAGCTCATGGACAGTGGCACCAATGTCATGCCTCAAGATCTTGATGATGTTTGTCAGAGCAGGCAGGCTACGTTTATCCAAATGGGTGAAAAATTCATACTCATCTTTCTTTAAACGAGAAGGTCTAGATTCAATGTGGGTCAGGTTTACATCATTCT-A
• rs199475570
• NM_000277.3:c.170_352+1del

Variant summary

Our verdict is Likely pathogenic. The variant received 8 ACMG points: 8P and 0B. PVS1

The ENST00000553106.6(PAH):​c.170_352+1del​(p.Glu57_Thr117del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency: Genomes: not found (cov: 32)
• Consequence: PAH ENST00000553106.6 splice_donor, disruptive_inframe_deletion, splice_region, intron
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 8.90
• Publications: 3 publications found

Genes affected

PAH (HGNC:8582): (phenylalanine hydroxylase) This gene encodes a member of the biopterin-dependent aromatic amino acid hydroxylase protein family. The encoded phenylalanine hydroxylase enzyme hydroxylates phenylalanine to tyrosine and is the rate-limiting step in phenylalanine catabolism. Deficiency of this enzyme activity results in the autosomal recessive disorder phenylketonuria. [provided by RefSeq, Aug 2017]

PAH Gene-Disease associations (from GenCC):

• phenylketonuria

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P, ClinGen, Myriad Women’s Health
• classic phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• maternal phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• mild hyperphenylalaninemia

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• mild phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
• tetrahydrobiopterin-responsive hyperphenylalaninemia/phenylketonuria

  Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

LOC124902999 (HGNC:):

ACMG classification

Our verdict: Likely_pathogenic. The variant received 8 ACMG points.

• PVS1: Splicing +-2 bp (donor or acceptor) variant, LoF is a know mechanism of disease, No cryptic splice site detected. Exon removal results in frameshift change.

Variant Effect in Transcripts

ACMG analysis was done for transcript: ENST00000553106.6. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PAH	NM_000277.3	MANE Select	c.170_352+1del	p.Glu57_Thr117del	splice_donor disruptive_inframe_deletion splice_region intron	Exon 3 of 13	NP_000268.1
	PAH	NM_001354304.2		c.170_352+1del	p.Glu57_Thr117del	splice_donor disruptive_inframe_deletion splice_region intron	Exon 4 of 14	NP_001341233.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PAH	ENST00000553106.6	TSL:1 MANE Select	c.170_352+1del	p.Glu57_Thr117del	splice_donor disruptive_inframe_deletion splice_region intron	Exon 3 of 13	ENSP00000448059.1
	PAH	ENST00000549111.5	TSL:1	n.266_448+1del		splice_donor splice_region intron non_coding_transcript_exon	Exon 3 of 6
	PAH	ENST00000546844.1	TSL:3	c.170_*1del	p.Glu57_Thr117del	conservative_inframe_deletion splice_region	Exon 4 of 4	ENSP00000446658.1

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		8.9

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs199475570; hg19: chr12-103288511;