chr12-122208400-GCCTCCTGCTCCGACTCAGCCCGCT-G

Variant names:

• chr12-122208400-GCCTCCTGCTCCGACTCAGCCCGCT-G
• rs752361472
• NM_001371333.1:c.677_700delAGCGGGCTGAGTCGGAGCAGGAGG

Variant summary

Our verdict is Likely benign. Variant got -4 ACMG points: 2P and 6B. PM4 BP6_Moderate BS2

The NM_001371333.1(DIABLO):​c.677_700delAGCGGGCTGAGTCGGAGCAGGAGG​(p.Glu226_Glu233del) variant causes a disruptive inframe deletion change. The variant allele was found at a frequency of 0.000049 in 1,612,562 control chromosomes in the GnomAD database, including 1 homozygotes. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000053 (1 hom.)
• Consequence: DIABLO NM_001371333.1 disruptive_inframe_deletion
• Clinical Significance: Likely benign criteria provided, single submitter B:2
• Conservation: PhyloP100: 6.20

Genes affected

DIABLO (HGNC:21528): (diablo IAP-binding mitochondrial protein) This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]

B3GNT4 (HGNC:15683): (UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4) This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase protein family. The encoded enzyme is involved in the biosynthesis of poly-N-acetyllactosamine chains and prefers lacto-N-neotetraose as a substrate. It is a type II transmembrane protein. [provided by RefSeq, Jul 2008]

ENSG00000256861 (HGNC:):

ACMG classification

Verdict is Likely_benign. Variant got -4 ACMG points.

• PM4: Nonframeshift variant in NON repetitive region in NM_001371333.1.
• BP6: Variant 12-122208400-GCCTCCTGCTCCGACTCAGCCCGCT-G is Benign according to our data. Variant chr12-122208400-GCCTCCTGCTCCGACTCAGCCCGCT-G is described in ClinVar as [Likely_benign]. Clinvar id is 1633306.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS2: High AC in GnomAdExome4 at 77 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
DIABLO	NM_001371333.1	c.677_700delAGCGGGCTGAGTCGGAGCAGGAGG	p.Glu226_Glu233del	disruptive_inframe_deletion	Exon 6 of 6	ENST00000464942.7	NP_001358262.1
B3GNT4	NM_030765.4	c.*1018_*1041delTGCTCCGACTCAGCCCGCTCCTCC		3_prime_UTR_variant	Exon 3 of 3	ENST00000324189.5	NP_110392.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
DIABLO	ENST00000464942.7	c.677_700delAGCGGGCTGAGTCGGAGCAGGAGG	p.Glu226_Glu233del	disruptive_inframe_deletion	Exon 6 of 6	1	NM_001371333.1	ENSP00000442360.2
B3GNT4	ENST00000324189.5	c.*1018_*1041delTGCTCCGACTCAGCCCGCTCCTCC		3_prime_UTR_variant	Exon 3 of 3	1	NM_030765.4	ENSP00000319636.4
ENSG00000256861	ENST00000535844.1	n.*471_*494delAGCGGGCTGAGTCGGAGCAGGAGG		non_coding_transcript_exon_variant	Exon 16 of 16	2		ENSP00000454454.1
ENSG00000256861	ENST00000535844.1	n.*471_*494delAGCGGGCTGAGTCGGAGCAGGAGG		3_prime_UTR_variant	Exon 16 of 16	2		ENSP00000454454.1

Frequencies

GnomAD3 genomes AF: 0.0000131 AC: 2 AN: 152198 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.000414

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.000100 AC: 25 AN: 249142 Hom.: 0 AF XY: 0.000178 AC XY: 24 AN XY: 134818

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.000818

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000527 AC: 77 AN: 1460364 Hom.: 1 AF XY: 0.0000840 AC XY: 61 AN XY: 726456

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.000870

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.0000332

GnomAD4 genome AF: 0.0000131 AC: 2 AN: 152198 Hom.: 0 Cov.: 32 AF XY: 0.0000135 AC XY: 1 AN XY: 74348

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.000414

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.00

Gnomad4 OTH AF: 0.00

ClinVar

Significance: Likely benign

Submissions summary: Benign:2

Revision: criteria provided, single submitter

Submissions by phenotype

DIABLO-related disorder Benign:1

Oct 24, 2023

PreventionGenetics, part of Exact Sciences

Significance: Likely benign

Review Status: no assertion criteria provided

Collection Method: clinical testing

This variant is classified as likely benign based on ACMG/AMP sequence variant interpretation guidelines (Richards et al. 2015 PMID: 25741868, with internal and published modifications). -

not provided Benign:1

Dec 17, 2020

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Likely benign

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs752361472; hg19: chr12-122692947;