chr12-132659281-GGGGGAGCCCTCACCTCTCCGTGACA-G
Variant summary
Our verdict is Likely pathogenic. Variant got 9 ACMG points: 9P and 0B. PVS1PP5
The NM_006231.4(POLE):c.3264_3275+13delTGTCACGGAGAGGTGAGGGCTCCCC(p.Val1089_Arg1092del) variant causes a splice donor, disruptive inframe deletion, splice region, intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000112 in 1,610,294 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).
Frequency
Consequence
NM_006231.4 splice_donor, disruptive_inframe_deletion, splice_region, intron
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Likely_pathogenic. Variant got 9 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
POLE | NM_006231.4 | c.3264_3275+13delTGTCACGGAGAGGTGAGGGCTCCCC | p.Val1089_Arg1092del | splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant | 26/49 | ENST00000320574.10 | NP_006222.2 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
POLE | ENST00000320574.10 | c.3264_3275+13delTGTCACGGAGAGGTGAGGGCTCCCC | p.Val1089_Arg1092del | splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant | 26/49 | 1 | NM_006231.4 | ENSP00000322570.5 |
Frequencies
GnomAD3 genomes AF: 0.0000198 AC: 3AN: 151554Hom.: 0 Cov.: 33
GnomAD3 exomes AF: 0.0000121 AC: 3AN: 247110Hom.: 0 AF XY: 0.0000149 AC XY: 2AN XY: 133952
GnomAD4 exome AF: 0.0000103 AC: 15AN: 1458740Hom.: 0 AF XY: 0.0000110 AC XY: 8AN XY: 725774
GnomAD4 genome AF: 0.0000198 AC: 3AN: 151554Hom.: 0 Cov.: 33 AF XY: 0.0000270 AC XY: 2AN XY: 74030
ClinVar
Submissions by phenotype
not provided Pathogenic:4
Likely pathogenic, criteria provided, single submitter | clinical testing | Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital | Aug 15, 2023 | - - |
Likely pathogenic, criteria provided, single submitter | clinical testing | Institute for Clinical Genetics, University Hospital TU Dresden, University Hospital TU Dresden | Nov 03, 2021 | - - |
Pathogenic, criteria provided, single submitter | clinical testing | Labcorp Genetics (formerly Invitae), Labcorp | Dec 26, 2023 | This variant results in the deletion of part of exon 26 (c.3264_3275+13del) of the POLE gene. RNA analysis indicates that this variant induces altered splicing and may result in an absent or disrupted protein product. This variant is present in population databases (rs761516512, gnomAD 0.01%). This variant has not been reported in the literature in individuals affected with POLE-related conditions. ClinVar contains an entry for this variant (Variation ID: 473580). Studies have shown that this variant results in activation of a cryptic splice site and introduces a premature termination codon (Invitae). The resulting mRNA is expected to undergo nonsense-mediated decay. For these reasons, this variant has been classified as Pathogenic. - |
Pathogenic, criteria provided, single submitter | clinical testing | GeneDx | Dec 17, 2023 | Canonical splice site variant predicted to result in a null allele in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 34502317, 36395985, 35312039, 30503519) - |
Hereditary cancer-predisposing syndrome Uncertain:1
Uncertain significance, criteria provided, single submitter | clinical testing | Ambry Genetics | Oct 16, 2019 | The c.3264_3275+13del25 variant spans the boundary of coding exon 26 and intron 26 in the POLE gene. This variant results from a deletion of 25 nucleotides at positions c.3264 to c.3275+13. These nucleotide positions are well conserved in available vertebrate species. Using the BDGP and ESEfinder splice site prediction tools, this alteration is predicted to abolish the native splice donor site and create a new alternate splice donor site; however, direct evidence is unavailable. This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. However, loss of function via haploinsufficiency in POLE has not been clearly established as a mechanism of disease. Since supporting evidence is limited at this time, the clinical significance of this alteration remains unclear. - |
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at