rs761516512

Variant names:

• chr12-132659281-GGGGGAGCCCTCACCTCTCCGTGACA-G
• rs761516512
• ENST00000537064.5:n.*2311_*2322+13delTGTCACGGAGAGGTGAGGGCTCCCC

Your query was ambiguous. Multiple possible variants found:

• chr12-132659281-GGGGGAGCCCTCACCTCTCCGTGACA-G
• chr12-132659281-GGGGGAGCCCTCACCTCTCCGTGACA-GGGGGAGCCCTCACCTCTCCGTGACAGGGGAGCCCTCACCTCTCCGTGACA

Variant summary

Our verdict is Uncertain significance. The variant received 1 ACMG points: 1P and 0B. PP5

The ENST00000537064.5(POLE):​n.*2311_*2322+13delTGTCACGGAGAGGTGAGGGCTCCCC variant causes a splice region, non coding transcript exon change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0000112 in 1,610,294 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Conflicting classifications of pathogenicity (no stars).

• Frequency:
  • Genomes: 𝑓 0.000020 (0 hom., cov: 33)
  • Exomes 𝑓: 0.000010 (0 hom.)
• Consequence: POLE ENST00000537064.5 splice_region, non_coding_transcript_exon
• Clinical Significance: Conflicting classifications of pathogenicity criteria provided, conflicting classifications P:4 U:1
• Conservation: PhyloP100: 1.65
• Publications: 1 publications found

Genes affected

POLE (HGNC:9177): (DNA polymerase epsilon, catalytic subunit) This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]

POLE Gene-Disease associations (from GenCC):

• POLE-related polyposis and colorectal cancer syndrome

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• colorectal cancer, susceptibility to, 12

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Ambry Genetics
• facial dysmorphism-immunodeficiency-livedo-short stature syndrome

  Inheritance: AR Classification: STRONG, MODERATE, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae), Ambry Genetics
• intrauterine growth retardation, metaphyseal dysplasia, adrenal hypoplasia congenita, genital anomalies, and immunodeficiency

  Inheritance: AR Classification: STRONG Submitted by: G2P
• IMAGe syndrome

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Polymerase proofreading-related adenomatous polyposis

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Uncertain_significance. The variant received 1 ACMG points.

• PP5: Variant 12-132659281-GGGGGAGCCCTCACCTCTCCGTGACA-G is Pathogenic according to our data. Variant chr12-132659281-GGGGGAGCCCTCACCTCTCCGTGACA-G is described in ClinVar as Conflicting_classifications_of_pathogenicity. ClinVar VariationId is 473580.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
POLE	NM_006231.4	c.3264_3275+13delTGTCACGGAGAGGTGAGGGCTCCCC	p.Val1089_Arg1092del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 26 of 49	ENST00000320574.10	NP_006222.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
POLE	ENST00000320574.10	c.3264_3275+13delTGTCACGGAGAGGTGAGGGCTCCCC	p.Val1089_Arg1092del	splice_donor_variant, disruptive_inframe_deletion, splice_region_variant, intron_variant	Exon 26 of 49	1	NM_006231.4	ENSP00000322570.5

Frequencies

GnomAD3 genomes AF: 0.0000198 AC: 3 AN: 151554 Hom.: 0 Cov.: 33

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.000285

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.00

Gnomad OTH AF: 0.00

GnomAD2 exomes AF: 0.0000121 AC: 3 AN: 247110 AF XY: 0.0000149

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.0000472

Gnomad NFE exome AF: 0.0000181

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000103 AC: 15 AN: 1458740 Hom.: 0 AF XY: 0.0000110 AC XY: 8 AN XY: 725774

African (AFR) AF: 0.00 AC: 0 AN: 33432

American (AMR) AF: 0.00 AC: 0 AN: 44656

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26092

East Asian (EAS) AF: 0.00 AC: 0 AN: 39650

South Asian (SAS) AF: 0.0000232 AC: 2 AN: 86090

European-Finnish (FIN) AF: 0.000133 AC: 7 AN: 52812

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5722

European-Non Finnish (NFE) AF: 0.00000541 AC: 6 AN: 1110032

Other (OTH) AF: 0.00 AC: 0 AN: 60254

GnomAD4 genome AF: 0.0000198 AC: 3 AN: 151554 Hom.: 0 Cov.: 33 AF XY: 0.0000270 AC XY: 2 AN XY: 74030

African (AFR) AF: 0.00 AC: 0 AN: 41262

American (AMR) AF: 0.00 AC: 0 AN: 15220

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 3466

East Asian (EAS) AF: 0.00 AC: 0 AN: 5176

South Asian (SAS) AF: 0.00 AC: 0 AN: 4800

European-Finnish (FIN) AF: 0.000285 AC: 3 AN: 10514

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 316

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 67800

Other (OTH) AF: 0.00 AC: 0 AN: 2092

Alfa AF: 0.00 Hom.: 0

ClinVar

Significance: Conflicting classifications of pathogenicity

Submissions summary: Pathogenic:4 Uncertain:1

Revision: criteria provided, conflicting classifications

Submissions by phenotype

not provided Pathogenic:4

Nov 03, 2021

Institute for Clinical Genetics, University Hospital TU Dresden, University Hospital TU Dresden

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Dec 17, 2023

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Canonical splice site variant predicted to result in a null allele in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 34502317, 36395985, 35312039, 30503519) -

Nov 11, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant results in the deletion of part of exon 26 (c.3264_3275+13del) of the POLE gene. RNA analysis indicates that this variant induces altered splicing and may result in an absent or altered protein product. This variant is present in population databases (rs761516512, gnomAD 0.01%). This variant has not been reported in the literature in individuals affected with POLE-related conditions. ClinVar contains an entry for this variant (Variation ID: 473580). Studies have shown that this variant results in activation of a cryptic splice site, and produces a non-functional protein and/or introduces a premature termination codon (internal data). For these reasons, this variant has been classified as Pathogenic. -

Mar 04, 2025

Center for Genomic Medicine, Rigshospitalet, Copenhagen University Hospital

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Hereditary cancer-predisposing syndrome Uncertain:1

Jan 07, 2025

Ambry Genetics

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.3264_3275+13del25 variant spans the boundary of coding exon 26 and intron 26 in the POLE gene. This variant results from a deletion of 25 nucleotides at positions c.3264 to c.3275+13. This variant has been identified in trans with a second POLE variant in an individual with features consistent with POLE deficiency (Logan CV et al. Am J Hum Genet, 2018 Dec;103:1038-1044). These nucleotide positions are well conserved in available vertebrate species. In silico splice site analysis predicts that this alteration will weaken the native splice donor site and may result in the creation or strengthening of a novel splice donor site; however, direct evidence is unavailable. This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. Loss-of-function variants subject to nonsense mediated decay (NMD) in POLE are known to cause POLE deficiency; however, such associations with POLE-related polymerase proofreading-associated polyposis (PPAP) have not been reported. Based on the supporting evidence, this alteration is pathogenic for POLE deficiency; however, the association of this alteration with POLE-related polymerase proofreading-associated polyposis (PPAP) and POLE-related CMMRD-like syndrome is unknown. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		1.7
Mutation Taster		=19/181	disease causing (long InDel)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs761516512; hg19: chr12-133235867; COSMIC: COSV57683732;