chr12-32877897-CCCCCTGCGGCCGCCTGGCCGACAGTCAAGTGC-GT
Variant summary
Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1PP5_Moderate
The NM_001005242.3(PKP2):c.951_983delGCACTTGACTGTCGGCCAGGCGGCCGCAGGGGGinsAC(p.His318GlnfsTer24) variant causes a frameshift, missense change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A317A) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_001005242.3 frameshift, missense
Scores
Clinical Significance
Conservation
Publications
- arrhythmogenic right ventricular cardiomyopathyInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- arrhythmogenic right ventricular dysplasia 9Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
- left ventricular noncompactionInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- Brugada syndromeInheritance: AD Classification: LIMITED Submitted by: Genomics England PanelApp
- Brugada syndrome 1Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
- catecholaminergic polymorphic ventricular tachycardiaInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
- dilated cardiomyopathyInheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 10 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001005242.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PKP2 | NM_001005242.3 | MANE Select | c.951_983delGCACTTGACTGTCGGCCAGGCGGCCGCAGGGGGinsAC | p.His318GlnfsTer24 | frameshift missense | Exon 3 of 13 | NP_001005242.2 | ||
| PKP2 | NM_004572.4 | c.951_983delGCACTTGACTGTCGGCCAGGCGGCCGCAGGGGGinsAC | p.His318GlnfsTer24 | frameshift missense | Exon 3 of 14 | NP_004563.2 | |||
| PKP2 | NM_001407155.1 | c.951_983delGCACTTGACTGTCGGCCAGGCGGCCGCAGGGGGinsAC | p.His318GlnfsTer24 | frameshift missense | Exon 3 of 12 | NP_001394084.1 |
Ensembl Transcripts
| Selected | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PKP2 | ENST00000340811.9 | TSL:1 MANE Select | c.951_983delGCACTTGACTGTCGGCCAGGCGGCCGCAGGGGGinsAC | p.His318GlnfsTer24 | frameshift missense | Exon 3 of 13 | ENSP00000342800.5 | ||
| PKP2 | ENST00000070846.11 | TSL:1 | c.951_983delGCACTTGACTGTCGGCCAGGCGGCCGCAGGGGGinsAC | p.His318GlnfsTer24 | frameshift missense | Exon 3 of 14 | ENSP00000070846.6 | ||
| PKP2 | ENST00000700559.2 | c.951_983delGCACTTGACTGTCGGCCAGGCGGCCGCAGGGGGinsAC | p.His318GlnfsTer24 | frameshift missense | Exon 3 of 12 | ENSP00000515065.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Submissions by phenotype
Arrhythmogenic right ventricular cardiomyopathy Pathogenic:1
The p.His318fsX24 variant in PKP2 has been identified in one individual with arrhythmogenic right ventricular cardiomyopathy (ARVC) and segregated with disease in at least 3 affected relatives, including one obligate carrier (LMM data). It was absent from large population studies. This variant is predicted to cause a frameshift, which alters the protein’s amino acid sequence beginning at position 318 and leads to a premature termination codon 24 amino acids downstream. This alteration is then predicted to lead to a truncated or absent protein. Loss of function of the ARVC gene is an established disease mechanism in autosomal dominant ARVC. In summary, this variant meets criteria to be classified as pathogenic for autosomal dominant ARVC. ACMG/AMP Criteria applied: PVS1; PM2_Supporting, PP1.
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at