rs397517030

Variant names:

• chr12-32877897-CCCCCTGCGGCCGCCTGGCCGACAGTCAAGTGC-GT
• rs397517030
• NM_001005242.3:c.951_983delGCACTTGACTGTCGGCCAGGCGGCCGCAGGGGGinsAC

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001005242.3(PKP2):​c.951_983delGCACTTGACTGTCGGCCAGGCGGCCGCAGGGGGinsAC​(p.His318GlnfsTer24) variant causes a frameshift, missense change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. A317A) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: PKP2 NM_001005242.3 frameshift, missense
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 5.68
• Publications: 1 publications found

Genes affected

PKP2 (HGNC:9024): (plakophilin 2) This gene encodes a member of the arm-repeat (armadillo) and plakophilin gene families. Plakophilin proteins contain numerous armadillo repeats, localize to cell desmosomes and nuclei, and participate in linking cadherins to intermediate filaments in the cytoskeleton. This gene may regulate the signaling activity of beta-catenin and is required to maintain transcription of genes that control intracellular calcium cycling including ryanodine receptor 2, ankyrin-B, triadin, and calcium channel, voltage-dependent, L type, alpha 1C. Mutations in this gene are associated with different inherited cardiac conditions including Arrythmogenic Cardiomyopathy, Brugada Syndrome, and Idiopathic Ventricular Fibrillation. A processed pseudogene with high similarity to this gene has been mapped to chromosome 12p13. [provided by RefSeq, May 2022]

PKP2 Gene-Disease associations (from GenCC):

• arrhythmogenic right ventricular cardiomyopathy

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• arrhythmogenic right ventricular dysplasia 9

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• left ventricular noncompaction

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• Brugada syndrome

  Inheritance: AD Classification: LIMITED Submitted by: Genomics England PanelApp
• Brugada syndrome 1

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• catecholaminergic polymorphic ventricular tachycardia

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen
• dilated cardiomyopathy

  Inheritance: AD Classification: NO_KNOWN Submitted by: ClinGen

ENSG00000309501 (HGNC:):

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 12-32877897-CCCCCTGCGGCCGCCTGGCCGACAGTCAAGTGC-GT is Pathogenic according to our data. Variant chr12-32877897-CCCCCTGCGGCCGCCTGGCCGACAGTCAAGTGC-GT is described in ClinVar as Pathogenic. ClinVar VariationId is 45091.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
PKP2	NM_001005242.3	c.951_983delGCACTTGACTGTCGGCCAGGCGGCCGCAGGGGGinsAC	p.His318GlnfsTer24	frameshift_variant, missense_variant	Exon 3 of 13	ENST00000340811.9	NP_001005242.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
PKP2	ENST00000340811.9	c.951_983delGCACTTGACTGTCGGCCAGGCGGCCGCAGGGGGinsAC	p.His318GlnfsTer24	frameshift_variant, missense_variant	Exon 3 of 13	1	NM_001005242.3	ENSP00000342800.5

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Arrhythmogenic right ventricular cardiomyopathy Pathogenic:1

Dec 15, 2021

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The p.His318fsX24 variant in PKP2 has been identified in one individual with arrhythmogenic right ventricular cardiomyopathy (ARVC) and segregated with disease in at least 3 affected relatives, including one obligate carrier (LMM data). It was absent from large population studies. This variant is predicted to cause a frameshift, which alters the protein’s amino acid sequence beginning at position 318 and leads to a premature termination codon 24 amino acids downstream. This alteration is then predicted to lead to a truncated or absent protein. Loss of function of the ARVC gene is an established disease mechanism in autosomal dominant ARVC. In summary, this variant meets criteria to be classified as pathogenic for autosomal dominant ARVC. ACMG/AMP Criteria applied: PVS1; PM2_Supporting, PP1. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		5.7

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs397517030; hg19: chr12-33030831;