chr12-48978756-TAAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAG-T

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PP5_Moderate

The NM_005430.4(WNT1):​c.104+4_104+44delAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAGA variant causes a splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

Frequency

Genomes: not found (cov: 33)

Consequence

WNT1
NM_005430.4 splice_region, intron

Scores

Not classified

Clinical Significance

Likely pathogenic criteria provided, single submitter P:1

Conservation

PhyloP100: 3.81

Publications

0 publications found
Variant links:
Genes affected
WNT1 (HGNC:12774): (Wnt family member 1) The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is very conserved in evolution, and the protein encoded by this gene is known to be 98% identical to the mouse Wnt1 protein at the amino acid level. The studies in mouse indicate that the Wnt1 protein functions in the induction of the mesencephalon and cerebellum. This gene was originally considered as a candidate gene for Joubert syndrome, an autosomal recessive disorder with cerebellar hypoplasia as a leading feature. However, further studies suggested that the gene mutations might not have a significant role in Joubert syndrome. This gene is clustered with another family member, WNT10B, in the chromosome 12q13 region. [provided by RefSeq, Jul 2008]
WNT1 Gene-Disease associations (from GenCC):
  • osteogenesis imperfecta type 15
    Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
  • idiopathic juvenile osteoporosis
    Inheritance: AD Classification: STRONG, LIMITED Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
  • osteogenesis imperfecta type 3
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
  • osteogenesis imperfecta type 4
    Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

PP5
Variant 12-48978756-TAAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAG-T is Pathogenic according to our data. Variant chr12-48978756-TAAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAG-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 488347.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
WNT1NM_005430.4 linkc.104+4_104+44delAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAGA splice_region_variant, intron_variant Intron 1 of 3 ENST00000293549.4 NP_005421.1 P04628

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
WNT1ENST00000293549.4 linkc.104+3_104+43delAAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAG splice_region_variant, intron_variant Intron 1 of 3 1 NM_005430.4 ENSP00000293549.3 P04628
ENSG00000305774ENST00000812875.1 linkn.147-2494_147-2454delCTGTGCCGCGGGACAAGTGGCGACCCCGCACCAGCTCACTT intron_variant Intron 1 of 1

Frequencies

GnomAD3 genomes
Cov.:
33
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
33

ClinVar

Significance: Likely pathogenic
Submissions summary: Pathogenic:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Osteogenesis imperfecta type 15 Pathogenic:1
Nov 29, 2017
Department of Paediatric Medicine, Post Graduation Institute of Medical Education and Research
Significance:Likely pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

The clinical significance was assigned and evaluated based on the ACMG guidelines for Variant Classification (Richards et al, 2015). This variant is absent in population databases (PM2); is a protein length changing variant (PM4); the patient's phenotype was highly specific for this gene (PP4) and multiple lines of computational evidence support a deleterious effect on the gene or gene product (PP3). It is an Autosomal Recessive variant and the parents were identified to be carriers. The proband's unaffected sister was also identified to be a carrier. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
3.8
Mutation Taster
=11/89
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs1555178899; hg19: chr12-49372539; API