rs1555178899

Variant names:

• chr12-48978756-TAAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAG-T
• rs1555178899
• NM_005430.4:c.104+4_104+44delAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAGA

Variant summary

Our verdict is Uncertain significance. The variant received 2 ACMG points: 2P and 0B. PP5_Moderate

The NM_005430.4(WNT1):​c.104+4_104+44delAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAGA variant causes a splice region, intron change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: WNT1 NM_005430.4 splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 3.81
• Publications: 0 publications found

Genes affected

WNT1 (HGNC:12774): (Wnt family member 1) The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is very conserved in evolution, and the protein encoded by this gene is known to be 98% identical to the mouse Wnt1 protein at the amino acid level. The studies in mouse indicate that the Wnt1 protein functions in the induction of the mesencephalon and cerebellum. This gene was originally considered as a candidate gene for Joubert syndrome, an autosomal recessive disorder with cerebellar hypoplasia as a leading feature. However, further studies suggested that the gene mutations might not have a significant role in Joubert syndrome. This gene is clustered with another family member, WNT10B, in the chromosome 12q13 region. [provided by RefSeq, Jul 2008]

WNT1 Gene-Disease associations (from GenCC):

• osteogenesis imperfecta type 15

  Inheritance: AR Classification: DEFINITIVE, STRONG Submitted by: Labcorp Genetics (formerly Invitae), G2P
• idiopathic juvenile osteoporosis

  Inheritance: AD Classification: STRONG, LIMITED Submitted by: Ambry Genetics, Labcorp Genetics (formerly Invitae)
• osteogenesis imperfecta type 3

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
• osteogenesis imperfecta type 4

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ENSG00000305774 (HGNC:):

ACMG classification

Our verdict: Uncertain_significance. The variant received 2 ACMG points.

• PP5: Variant 12-48978756-TAAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAG-T is Pathogenic according to our data. Variant chr12-48978756-TAAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAG-T is described in ClinVar as Likely_pathogenic. ClinVar VariationId is 488347.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_005430.4. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	WNT1	NM_005430.4	MANE Select	c.104+4_104+44delAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAGA		splice_region intron	N/A	NP_005421.1	P04628

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	WNT1	ENST00000293549.4	TSL:1 MANE Select	c.104+3_104+43delAAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAG		splice_region intron	N/A	ENSP00000293549.3	P04628
	ENSG00000305774	ENST00000812875.1		n.147-2494_147-2454delCTGTGCCGCGGGACAAGTGGCGACCCCGCACCAGCTCACTT		intron	N/A

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

ClinVar submissions

Significance: Likely pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	Osteogenesis imperfecta type 15 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		3.8
Mutation Taster		=11/89	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555178899; hg19: chr12-49372539;