rs1555178899

Variant names:

• chr12-48978756-TAAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAG-T
• rs1555178899
• NM_005430.4:c.104+4_104+44delAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAGA

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM2 PP5_Moderate

The NM_005430.4(WNT1):​c.104+4_104+44delAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAGA variant causes a splice region, intron change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Likely pathogenic (★).

• Frequency: Genomes: not found (cov: 33)
• Consequence: WNT1 NM_005430.4 splice_region, intron
• Clinical Significance: Likely pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 3.81

Genes affected

WNT1 (HGNC:12774): (Wnt family member 1) The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It is very conserved in evolution, and the protein encoded by this gene is known to be 98% identical to the mouse Wnt1 protein at the amino acid level. The studies in mouse indicate that the Wnt1 protein functions in the induction of the mesencephalon and cerebellum. This gene was originally considered as a candidate gene for Joubert syndrome, an autosomal recessive disorder with cerebellar hypoplasia as a leading feature. However, further studies suggested that the gene mutations might not have a significant role in Joubert syndrome. This gene is clustered with another family member, WNT10B, in the chromosome 12q13 region. [provided by RefSeq, Jul 2008]

ACMG classification

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 12-48978756-TAAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAG-T is Pathogenic according to our data. Variant chr12-48978756-TAAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAG-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 488347.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
WNT1	NM_005430.4	c.104+4_104+44delAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAGA		splice_region_variant, intron_variant	Intron 1 of 3	ENST00000293549.4	NP_005421.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
WNT1	ENST00000293549.4	c.104+3_104+43delAAGTGAGCTGGTGCGGGGTCGCCACTTGTCCCGCGGCACAG		splice_region_variant, intron_variant	Intron 1 of 3	1	NM_005430.4	ENSP00000293549.3

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Likely pathogenic

Submissions summary: Pathogenic:1

Revision: criteria provided, single submitter

Submissions by phenotype

Osteogenesis imperfecta type 15 Pathogenic:1

Nov 29, 2017

Department of Paediatric Medicine, Post Graduation Institute of Medical Education and Research

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The clinical significance was assigned and evaluated based on the ACMG guidelines for Variant Classification (Richards et al, 2015). This variant is absent in population databases (PM2); is a protein length changing variant (PM4); the patient's phenotype was highly specific for this gene (PP4) and multiple lines of computational evidence support a deleterious effect on the gene or gene product (PP3). It is an Autosomal Recessive variant and the parents were identified to be carriers. The proband's unaffected sister was also identified to be a carrier. -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
Mutation Taster		=11/89	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555178899; hg19: chr12-49372539;