chr12-49950918-TCTGCCCTCAACTGGCCACAGGCC-T
Variant summary
Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1_StrongPM2PP5_Very_Strong
The NM_000486.6(AQP2):c.97_119delAACTGGCCACAGGCCCTGCCCTC(p.Asn33CysfsTer66) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,836 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★).
Frequency
Consequence
NM_000486.6 frameshift
Scores
Clinical Significance
Conservation
Genome browser will be placed here
ACMG classification
Verdict is Pathogenic. Variant got 14 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
AQP2 | ENST00000199280.4 | c.97_119delAACTGGCCACAGGCCCTGCCCTC | p.Asn33CysfsTer66 | frameshift_variant | Exon 1 of 4 | 1 | NM_000486.6 | ENSP00000199280.3 | ||
AQP2 | ENST00000550862.1 | c.97_119delAACTGGCCACAGGCCCTGCCCTC | p.Asn33CysfsTer66 | frameshift_variant | Exon 1 of 3 | 5 | ENSP00000450022.1 | |||
AQP2 | ENST00000551526.5 | n.97_119delAACTGGCCACAGGCCCTGCCCTC | non_coding_transcript_exon_variant | Exon 1 of 6 | 5 | ENSP00000447148.1 |
Frequencies
GnomAD3 genomes Cov.: 33
GnomAD3 exomes AF: 0.00000398 AC: 1AN: 251406Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 135888
GnomAD4 exome AF: 6.84e-7 AC: 1AN: 1461836Hom.: 0 AF XY: 0.00 AC XY: 0AN XY: 727206
GnomAD4 genome Cov.: 33
ClinVar
Submissions by phenotype
not provided Pathogenic:2
This sequence change creates a premature translational stop signal (p.Asn33Cysfs*66) in the AQP2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in AQP2 are known to be pathogenic (PMID: 9024277, 27156763). For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals with AQP2-related conditions. ClinVar contains an entry for this variant (Variation ID: 446862). The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the ExAC database. -
- -
Diabetes insipidus, nephrogenic, autosomal Pathogenic:1
- -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at