rs772201159

Positions:

• chr12-49950918-TCTGCCCTCAACTGGCCACAGGCC-T

Variant summary

Our verdict is Pathogenic. Variant got 14 ACMG points: 14P and 0B. PVS1_Strong PM2 PP5_Very_Strong

The NM_000486.6(AQP2):​c.97_119delAACTGGCCACAGGCCCTGCCCTC​(p.Asn33fs) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,836 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: AQP2 NM_000486.6 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 7.91

Genes affected

AQP2 (HGNC:634): (aquaporin 2) This gene encodes a water channel protein located in the kidney collecting tubule. It belongs to the MIP/aquaporin family, some members of which are clustered together on chromosome 12q13. Mutations in this gene have been linked to autosomal dominant and recessive forms of nephrogenic diabetes insipidus. [provided by RefSeq, Oct 2008]

ACMG classification

Verdict is Pathogenic. Variant got 14 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 17 pathogenic variants in the truncated region.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 12-49950918-TCTGCCCTCAACTGGCCACAGGCC-T is Pathogenic according to our data. Variant chr12-49950918-TCTGCCCTCAACTGGCCACAGGCC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 446862.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
AQP2	NM_000486.6	c.97_119delAACTGGCCACAGGCCCTGCCCTC	p.Asn33fs	frameshift_variant	1/4	ENST00000199280.4	NP_000477.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
AQP2	ENST00000199280.4	c.97_119delAACTGGCCACAGGCCCTGCCCTC	p.Asn33fs	frameshift_variant	1/4	1	NM_000486.6	ENSP00000199280.3
AQP2	ENST00000550862.1	c.97_119delAACTGGCCACAGGCCCTGCCCTC	p.Asn33fs	frameshift_variant	1/3	5		ENSP00000450022.1
AQP2	ENST00000551526.5	n.97_119delAACTGGCCACAGGCCCTGCCCTC		non_coding_transcript_exon_variant	1/6	5		ENSP00000447148.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD3 exomes AF: 0.00000398 AC: 1 AN: 251406 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 135888

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000289

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461836 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 727206

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.0000224

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:2

Likely pathogenic, criteria provided, single submitter	clinical testing	Athena Diagnostics	Nov 11, 2016	- -
Pathogenic, criteria provided, single submitter	clinical testing	Labcorp Genetics (formerly Invitae), Labcorp	Mar 11, 2021	For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals with AQP2-related conditions. ClinVar contains an entry for this variant (Variation ID: 446862). The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the ExAC database. This sequence change creates a premature translational stop signal (p.Asn33Cysfs*66) in the AQP2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in AQP2 are known to be pathogenic (PMID: 9024277, 27156763). -

Diabetes insipidus, nephrogenic, autosomal Pathogenic:1

Likely pathogenic, criteria provided, single submitter

clinical testing

Fulgent Genetics, Fulgent Genetics

Feb 02, 2022

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs772201159; hg19: chr12-50344701;