rs772201159

Variant names:

• chr12-49950918-TCTGCCCTCAACTGGCCACAGGCC-T
• rs772201159
• NM_000486.6:c.97_119delAACTGGCCACAGGCCCTGCCCTC

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000486.6(AQP2):​c.97_119delAACTGGCCACAGGCCCTGCCCTC​(p.Asn33CysfsTer66) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.000000684 in 1,461,836 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Likely pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. N33N) has been classified as Likely benign.

• Frequency:
  • Genomes: not found (cov: 33)
  • Exomes 𝑓: 6.8e-7 (0 hom.)
• Consequence: AQP2 NM_000486.6 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:3
• Conservation: PhyloP100: 7.91
• Publications: 0 publications found

Genes affected

AQP2 (HGNC:634): (aquaporin 2) This gene encodes a water channel protein located in the kidney collecting tubule. It belongs to the MIP/aquaporin family, some members of which are clustered together on chromosome 12q13. Mutations in this gene have been linked to autosomal dominant and recessive forms of nephrogenic diabetes insipidus. [provided by RefSeq, Oct 2008]

AQP2 Gene-Disease associations (from GenCC):

• diabetes insipidus, nephrogenic, autosomal

  Inheritance: AD, AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae)
• nephrogenic diabetes insipidus

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant located near the start codon (<100nt), not predicted to undergo nonsense mediated mRNA decay. There are 58 pathogenic variants in the truncated region.
• PP5: Variant 12-49950918-TCTGCCCTCAACTGGCCACAGGCC-T is Pathogenic according to our data. Variant chr12-49950918-TCTGCCCTCAACTGGCCACAGGCC-T is described in ClinVar as [Likely_pathogenic]. Clinvar id is 446862.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
AQP2	NM_000486.6	c.97_119delAACTGGCCACAGGCCCTGCCCTC	p.Asn33CysfsTer66	frameshift_variant	Exon 1 of 4	ENST00000199280.4	NP_000477.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
AQP2	ENST00000199280.4	c.97_119delAACTGGCCACAGGCCCTGCCCTC	p.Asn33CysfsTer66	frameshift_variant	Exon 1 of 4	1	NM_000486.6	ENSP00000199280.3
AQP2	ENST00000550862.1	c.97_119delAACTGGCCACAGGCCCTGCCCTC	p.Asn33CysfsTer66	frameshift_variant	Exon 1 of 3	5		ENSP00000450022.1
AQP2	ENST00000551526.5	n.97_119delAACTGGCCACAGGCCCTGCCCTC		non_coding_transcript_exon_variant	Exon 1 of 6	5		ENSP00000447148.1

Frequencies

GnomAD3 genomes Cov.: 33

GnomAD2 exomes AF: 0.00000398 AC: 1 AN: 251406 AF XY: 0.00

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.0000289

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.00

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 6.84e-7 AC: 1 AN: 1461836 Hom.: 0 AF XY: 0.00 AC XY: 0 AN XY: 727206

⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.

African (AFR) AF: 0.00 AC: 0 AN: 33480

American (AMR) AF: 0.0000224 AC: 1 AN: 44720

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 26136

East Asian (EAS) AF: 0.00 AC: 0 AN: 39696

South Asian (SAS) AF: 0.00 AC: 0 AN: 86258

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 53402

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 5768

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 1111980

Other (OTH) AF: 0.00 AC: 0 AN: 60396

⚠️ The allele balance in gnomAD4 Exomes is highly skewed from 0.5 (p-value = 0.000000), which strongly suggests a high chance of mosaicism in these individuals.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:3

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:2

Nov 11, 2016

Athena Diagnostics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Mar 11, 2021

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Asn33Cysfs*66) in the AQP2 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in AQP2 are known to be pathogenic (PMID: 9024277, 27156763). For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals with AQP2-related conditions. ClinVar contains an entry for this variant (Variation ID: 446862). The frequency data for this variant in the population databases is considered unreliable, as metrics indicate poor data quality at this position in the ExAC database. -

Diabetes insipidus, nephrogenic, autosomal Pathogenic:1

Feb 02, 2022

Fulgent Genetics, Fulgent Genetics

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Computational scores

Source: dbNSFP v4.3

Name	Calibrated prediction	Score	Prediction
PhyloP100		7.9
Mutation Taster		=15/185	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs772201159; hg19: chr12-50344701;