chr12-51918985-GCATCGTGGAGGACTATAGAC-G

Variant names:

• chr12-51918985-GCATCGTGGAGGACTATAGAC-G
• rs1555153796
• NM_000020.3:c.1250_1269delTCGTGGAGGACTATAGACCA

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000020.3(ACVRL1):​c.1250_1269delTCGTGGAGGACTATAGACCA​(p.Ile417ThrfsTer4) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. I417I) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay. The gene ACVRL1 is included in the ClinGen Criteria Specification Registry.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ACVRL1 NM_000020.3 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 9.97
• Publications: 0 publications found

Genes affected

ACVRL1 (HGNC:175): (activin A receptor like type 1) This gene encodes a type I cell-surface receptor for the TGF-beta superfamily of ligands. It shares with other type I receptors a high degree of similarity in serine-threonine kinase subdomains, a glycine- and serine-rich region (called the GS domain) preceding the kinase domain, and a short C-terminal tail. The encoded protein, sometimes termed ALK1, shares similar domain structures with other closely related ALK or activin receptor-like kinase proteins that form a subfamily of receptor serine/threonine kinases. Mutations in this gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2. [provided by RefSeq, Jul 2008]

ACVRL1 Gene-Disease associations (from GenCC):

• telangiectasia, hereditary hemorrhagic, type 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, ClinGen, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
• hereditary hemorrhagic telangiectasia

  Inheritance: AR, AD Classification: SUPPORTIVE, LIMITED Submitted by: Ambry Genetics, Orphanet

ACMG classification

Specifications for ACVRL1 are available in the ClinGen Criteria Specification Registry and recommended for reference when assigning criteria.

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 12-51918985-GCATCGTGGAGGACTATAGAC-G is Pathogenic according to our data. Variant chr12-51918985-GCATCGTGGAGGACTATAGAC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 464756.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000020.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ACVRL1	NM_000020.3	MANE Select	c.1250_1269delTCGTGGAGGACTATAGACCA	p.Ile417ThrfsTer4	frameshift	Exon 9 of 10	NP_000011.2	P37023
	ACVRL1	NM_001077401.2		c.1250_1269delTCGTGGAGGACTATAGACCA	p.Ile417ThrfsTer4	frameshift	Exon 8 of 9	NP_001070869.1	A0A0S2Z310
	ACVRL1	NM_001406487.1		c.1250_1269delTCGTGGAGGACTATAGACCA	p.Ile417ThrfsTer4	frameshift	Exon 10 of 11	NP_001393416.1	A0A0S2Z310

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ACVRL1	ENST00000388922.9	TSL:1 MANE Select	c.1250_1269delTCGTGGAGGACTATAGACCA	p.Ile417ThrfsTer4	frameshift	Exon 9 of 10	ENSP00000373574.4	P37023
	ACVRL1	ENST00000550683.5	TSL:1	c.1292_1311delTCGTGGAGGACTATAGACCA	p.Ile431ThrfsTer4	frameshift	Exon 8 of 9	ENSP00000447884.1	G3V1W8
	ACVRL1	ENST00000551576.6	TSL:1	c.1250_1269delTCGTGGAGGACTATAGACCA	p.Ile417ThrfsTer4	frameshift	Exon 10 of 11	ENSP00000455848.2	P37023

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	-	-	Cardiovascular phenotype (1)
1	-	-	Telangiectasia, hereditary hemorrhagic, type 2 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		10
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555153796; hg19: chr12-52312769;