chr12-51918985-GCATCGTGGAGGACTATAGAC-G
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_000020.3(ACVRL1):c.1250_1269delTCGTGGAGGACTATAGACCA(p.Ile417ThrfsTer4) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. I417I) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.
Frequency
Consequence
NM_000020.3 frameshift
Scores
Clinical Significance
Conservation
Publications
- telangiectasia, hereditary hemorrhagic, type 2Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp
- hereditary hemorrhagic telangiectasiaInheritance: AR, AD Classification: SUPPORTIVE, LIMITED Submitted by: Ambry Genetics, Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_000020.3. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ACVRL1 | NM_000020.3 | MANE Select | c.1250_1269delTCGTGGAGGACTATAGACCA | p.Ile417ThrfsTer4 | frameshift | Exon 9 of 10 | NP_000011.2 | ||
| ACVRL1 | NM_001077401.2 | c.1250_1269delTCGTGGAGGACTATAGACCA | p.Ile417ThrfsTer4 | frameshift | Exon 8 of 9 | NP_001070869.1 | |||
| ACVRL1 | NM_001406487.1 | c.1250_1269delTCGTGGAGGACTATAGACCA | p.Ile417ThrfsTer4 | frameshift | Exon 10 of 11 | NP_001393416.1 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ACVRL1 | ENST00000388922.9 | TSL:1 MANE Select | c.1250_1269delTCGTGGAGGACTATAGACCA | p.Ile417ThrfsTer4 | frameshift | Exon 9 of 10 | ENSP00000373574.4 | ||
| ACVRL1 | ENST00000550683.5 | TSL:1 | c.1292_1311delTCGTGGAGGACTATAGACCA | p.Ile431ThrfsTer4 | frameshift | Exon 8 of 9 | ENSP00000447884.1 | ||
| ACVRL1 | ENST00000551576.6 | TSL:1 | c.1250_1269delTCGTGGAGGACTATAGACCA | p.Ile417ThrfsTer4 | frameshift | Exon 10 of 11 | ENSP00000455848.2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at