rs1555153796

Variant names:

• chr12-51918985-GCATCGTGGAGGACTATAGAC-G
• rs1555153796
• NM_000020.3:c.1250_1269delTCGTGGAGGACTATAGACCA

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1 PM2 PP5_Very_Strong

The NM_000020.3(ACVRL1):​c.1250_1269delTCGTGGAGGACTATAGACCA​(p.Ile417ThrfsTer4) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ACVRL1 NM_000020.3 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 9.97

Genes affected

ACVRL1 (HGNC:175): (activin A receptor like type 1) This gene encodes a type I cell-surface receptor for the TGF-beta superfamily of ligands. It shares with other type I receptors a high degree of similarity in serine-threonine kinase subdomains, a glycine- and serine-rich region (called the GS domain) preceding the kinase domain, and a short C-terminal tail. The encoded protein, sometimes termed ALK1, shares similar domain structures with other closely related ALK or activin receptor-like kinase proteins that form a subfamily of receptor serine/threonine kinases. Mutations in this gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2. [provided by RefSeq, Jul 2008]

ACMG classification

Verdict is Pathogenic. Variant got 18 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PM2: Very rare variant in population databases, with high coverage
• PP5: Variant 12-51918985-GCATCGTGGAGGACTATAGAC-G is Pathogenic according to our data. Variant chr12-51918985-GCATCGTGGAGGACTATAGAC-G is described in ClinVar as [Pathogenic]. Clinvar id is 464756.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
ACVRL1	NM_000020.3	c.1250_1269delTCGTGGAGGACTATAGACCA	p.Ile417ThrfsTer4	frameshift_variant	Exon 9 of 10	ENST00000388922.9	NP_000011.2

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
ACVRL1	ENST00000388922.9	c.1250_1269delTCGTGGAGGACTATAGACCA	p.Ile417ThrfsTer4	frameshift_variant	Exon 9 of 10	1	NM_000020.3	ENSP00000373574.4

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:2

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

Telangiectasia, hereditary hemorrhagic, type 2 Pathogenic:1

Jul 03, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change deletes 20 nucleotides from exon 9 of the ACVRL1 mRNA (c.1250_1269delTCGTGGAGGACTATAGACCA), causing a frameshift at codon 417. This creates a premature translational stop signal (p.Ile417Thrfs*4) and is expected to result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, loss-of-function variants in ACVRL1 are known to be pathogenic (PMID: 15879500). For these reasons, this variant has been classified as Pathogenic. -

Cardiovascular phenotype Pathogenic:1

Nov 19, 2020

Ambry Genetics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The c.1250_1269del20 pathogenic mutation, located in coding exon 8 of the ACVRL1 gene, results from a deletion of 20 nucleotides at nucleotide positions 1250 to 1269, causing a translational frameshift with a predicted alternate stop codon (p.I417Tfs*4). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555153796; hg19: chr12-52312769;