rs1555153796

Variant names:

• chr12-51918985-GCATCGTGGAGGACTATAGAC-G
• rs1555153796
• NM_000020.3:c.1250_1269delTCGTGGAGGACTATAGACCA

Variant summary

Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_000020.3(ACVRL1):​c.1250_1269delTCGTGGAGGACTATAGACCA​(p.Ile417ThrfsTer4) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. I417I) has been classified as Likely benign. Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: ACVRL1 NM_000020.3 frameshift
• Clinical Significance: Pathogenic criteria provided, multiple submitters, no conflicts P:2
• Conservation: PhyloP100: 9.97
• Publications: 0 publications found

Genes affected

ACVRL1 (HGNC:175): (activin A receptor like type 1) This gene encodes a type I cell-surface receptor for the TGF-beta superfamily of ligands. It shares with other type I receptors a high degree of similarity in serine-threonine kinase subdomains, a glycine- and serine-rich region (called the GS domain) preceding the kinase domain, and a short C-terminal tail. The encoded protein, sometimes termed ALK1, shares similar domain structures with other closely related ALK or activin receptor-like kinase proteins that form a subfamily of receptor serine/threonine kinases. Mutations in this gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2. [provided by RefSeq, Jul 2008]

ACVRL1 Gene-Disease associations (from GenCC):

• telangiectasia, hereditary hemorrhagic, type 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), ClinGen, Genomics England PanelApp
• hereditary hemorrhagic telangiectasia

  Inheritance: AR, AD Classification: SUPPORTIVE, LIMITED Submitted by: Ambry Genetics, Orphanet

ACMG classification

Our verdict: Pathogenic. The variant received 16 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 12-51918985-GCATCGTGGAGGACTATAGAC-G is Pathogenic according to our data. Variant chr12-51918985-GCATCGTGGAGGACTATAGAC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 464756.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000020.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ACVRL1	NM_000020.3	MANE Select	c.1250_1269delTCGTGGAGGACTATAGACCA	p.Ile417ThrfsTer4	frameshift	Exon 9 of 10	NP_000011.2
	ACVRL1	NM_001077401.2		c.1250_1269delTCGTGGAGGACTATAGACCA	p.Ile417ThrfsTer4	frameshift	Exon 8 of 9	NP_001070869.1
	ACVRL1	NM_001406487.1		c.1250_1269delTCGTGGAGGACTATAGACCA	p.Ile417ThrfsTer4	frameshift	Exon 10 of 11	NP_001393416.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	ACVRL1	ENST00000388922.9	TSL:1 MANE Select	c.1250_1269delTCGTGGAGGACTATAGACCA	p.Ile417ThrfsTer4	frameshift	Exon 9 of 10	ENSP00000373574.4
	ACVRL1	ENST00000550683.5	TSL:1	c.1292_1311delTCGTGGAGGACTATAGACCA	p.Ile431ThrfsTer4	frameshift	Exon 8 of 9	ENSP00000447884.1
	ACVRL1	ENST00000551576.6	TSL:1	c.1250_1269delTCGTGGAGGACTATAGACCA	p.Ile417ThrfsTer4	frameshift	Exon 10 of 11	ENSP00000455848.2

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions as Germline

Significance: Pathogenic

Revision: criteria provided, multiple submitters, no conflicts

Pathogenic	VUS	Benign	Condition
1	-	-	Cardiovascular phenotype (1)
1	-	-	Telangiectasia, hereditary hemorrhagic, type 2 (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		10
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555153796; hg19: chr12-52312769;