rs1555153796

Variant summary

Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong

The NM_000020.3(ACVRL1):​c.1250_1269delTCGTGGAGGACTATAGACCA​(p.Ile417ThrfsTer4) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.

Frequency

Genomes: not found (cov: 32)

Consequence

ACVRL1
NM_000020.3 frameshift

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, multiple submitters, no conflicts P:2

Conservation

PhyloP100: 9.97
Variant links:
Genes affected
ACVRL1 (HGNC:175): (activin A receptor like type 1) This gene encodes a type I cell-surface receptor for the TGF-beta superfamily of ligands. It shares with other type I receptors a high degree of similarity in serine-threonine kinase subdomains, a glycine- and serine-rich region (called the GS domain) preceding the kinase domain, and a short C-terminal tail. The encoded protein, sometimes termed ALK1, shares similar domain structures with other closely related ALK or activin receptor-like kinase proteins that form a subfamily of receptor serine/threonine kinases. Mutations in this gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2. [provided by RefSeq, Jul 2008]

Genome browser will be placed here

ACMG classification

Classification made for transcript

Verdict is Pathogenic. Variant got 18 ACMG points.

PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 12-51918985-GCATCGTGGAGGACTATAGAC-G is Pathogenic according to our data. Variant chr12-51918985-GCATCGTGGAGGACTATAGAC-G is described in ClinVar as [Pathogenic]. Clinvar id is 464756.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
ACVRL1NM_000020.3 linkc.1250_1269delTCGTGGAGGACTATAGACCA p.Ile417ThrfsTer4 frameshift_variant Exon 9 of 10 ENST00000388922.9 NP_000011.2 P37023A0A0S2Z310

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
ACVRL1ENST00000388922.9 linkc.1250_1269delTCGTGGAGGACTATAGACCA p.Ile417ThrfsTer4 frameshift_variant Exon 9 of 10 1 NM_000020.3 ENSP00000373574.4 P37023

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link

Submissions by phenotype

Telangiectasia, hereditary hemorrhagic, type 2 Pathogenic:1
Jul 03, 2017
Labcorp Genetics (formerly Invitae), Labcorp
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

This sequence change deletes 20 nucleotides from exon 9 of the ACVRL1 mRNA (c.1250_1269delTCGTGGAGGACTATAGACCA), causing a frameshift at codon 417. This creates a premature translational stop signal (p.Ile417Thrfs*4) and is expected to result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, loss-of-function variants in ACVRL1 are known to be pathogenic (PMID: 15879500). For these reasons, this variant has been classified as Pathogenic. -

Cardiovascular phenotype Pathogenic:1
Nov 19, 2020
Ambry Genetics
Significance: Pathogenic
Review Status: criteria provided, single submitter
Collection Method: clinical testing

The c.1250_1269del20 pathogenic mutation, located in coding exon 8 of the ACVRL1 gene, results from a deletion of 20 nucleotides at nucleotide positions 1250 to 1269, causing a translational frameshift with a predicted alternate stop codon (p.I417Tfs*4). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Below is the list of publications found by LitVar. It may be empty.

Other links and lift over

dbSNP: rs1555153796; hg19: chr12-52312769; API