rs1555153796
Positions:
Variant summary
Our verdict is Pathogenic. Variant got 18 ACMG points: 18P and 0B. PVS1PM2PP5_Very_Strong
The NM_000020.3(ACVRL1):c.1250_1269del(p.Ile417ThrfsTer4) variant causes a frameshift, splice region change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★★). Variant results in nonsense mediated mRNA decay.
Frequency
Genomes: not found (cov: 32)
Consequence
ACVRL1
NM_000020.3 frameshift, splice_region
NM_000020.3 frameshift, splice_region
Scores
Not classified
Clinical Significance
Conservation
PhyloP100: 9.97
Genes affected
ACVRL1 (HGNC:175): (activin A receptor like type 1) This gene encodes a type I cell-surface receptor for the TGF-beta superfamily of ligands. It shares with other type I receptors a high degree of similarity in serine-threonine kinase subdomains, a glycine- and serine-rich region (called the GS domain) preceding the kinase domain, and a short C-terminal tail. The encoded protein, sometimes termed ALK1, shares similar domain structures with other closely related ALK or activin receptor-like kinase proteins that form a subfamily of receptor serine/threonine kinases. Mutations in this gene are associated with hemorrhagic telangiectasia type 2, also known as Rendu-Osler-Weber syndrome 2. [provided by RefSeq, Jul 2008]
Genome browser will be placed here
ACMG classification
Classification made for transcript
Verdict is Pathogenic. Variant got 18 ACMG points.
PVS1
?
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
?
Very rare variant in population databases, with high coverage;
PP5
?
Variant 12-51918985-GCATCGTGGAGGACTATAGAC-G is Pathogenic according to our data. Variant chr12-51918985-GCATCGTGGAGGACTATAGAC-G is described in ClinVar as [Pathogenic]. Clinvar id is 464756.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | MANE | UniProt |
---|---|---|---|---|---|---|---|
ACVRL1 | NM_000020.3 | c.1250_1269del | p.Ile417ThrfsTer4 | frameshift_variant, splice_region_variant | 9/10 | ENST00000388922.9 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | #exon/exons | TSL | MANE | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|
ACVRL1 | ENST00000388922.9 | c.1250_1269del | p.Ile417ThrfsTer4 | frameshift_variant, splice_region_variant | 9/10 | 1 | NM_000020.3 | P1 |
Frequencies
GnomAD3 genomes ? Cov.: 32
GnomAD3 genomes
?
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome ? Cov.: 32
GnomAD4 genome
?
Cov.:
32
ClinVar
Significance: Pathogenic
Submissions summary: Pathogenic:2
Revision: criteria provided, multiple submitters, no conflicts
LINK: link
Submissions by phenotype
Telangiectasia, hereditary hemorrhagic, type 2 Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Invitae | Jul 03, 2017 | For these reasons, this variant has been classified as Pathogenic. While this particular variant has not been reported in the literature, loss-of-function variants in ACVRL1 are known to be pathogenic (PMID: 15879500). This sequence change deletes 20 nucleotides from exon 9 of the ACVRL1 mRNA (c.1250_1269delTCGTGGAGGACTATAGACCA), causing a frameshift at codon 417. This creates a premature translational stop signal (p.Ile417Thrfs*4) and is expected to result in an absent or disrupted protein product. - |
Cardiovascular phenotype Pathogenic:1
Pathogenic, criteria provided, single submitter | clinical testing | Ambry Genetics | Nov 19, 2020 | The c.1250_1269del20 pathogenic mutation, located in coding exon 8 of the ACVRL1 gene, results from a deletion of 20 nucleotides at nucleotide positions 1250 to 1269, causing a translational frameshift with a predicted alternate stop codon (p.I417Tfs*4). This alteration is expected to result in loss of function by premature protein truncation or nonsense-mediated mRNA decay. As such, this alteration is interpreted as a disease-causing mutation. - |
Computational scores
Source:
Name
Calibrated prediction
Score
Prediction
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at