chr12-6936728-ACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG-A
Variant summary
Our verdict is Uncertain significance. The variant received 0 ACMG points: 0P and 0B.
The NM_001940.4(ATN1):c.1473_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA(p.Gln491_Gln502del) variant causes a disruptive inframe deletion change. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar. Synonymous variant affecting the same amino acid position (i.e. Q491Q) has been classified as Likely benign.
Frequency
Consequence
NM_001940.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- congenital hypotonia, epilepsy, developmental delay, and digital anomaliesInheritance: AD Classification: STRONG, MODERATE Submitted by: Illumina, G2P, Labcorp Genetics (formerly Invitae), Ambry Genetics
- dentatorubral-pallidoluysian atrophyInheritance: AD Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Labcorp Genetics (formerly Invitae)
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 0 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_001940.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ATN1 | MANE Select | c.1473_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln491_Gln502del | disruptive_inframe_deletion | Exon 5 of 10 | NP_001931.2 | P54259 | ||
| ATN1 | c.1473_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln491_Gln502del | disruptive_inframe_deletion | Exon 5 of 10 | NP_001007027.1 | P54259 | |||
| ATN1 | c.1473_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln491_Gln502del | disruptive_inframe_deletion | Exon 5 of 10 | NP_001411105.1 | P54259 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| ATN1 | TSL:1 MANE Select | c.1473_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln491_Gln502del | disruptive_inframe_deletion | Exon 5 of 10 | ENSP00000379915.2 | P54259 | ||
| ATN1 | TSL:1 | c.1473_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln491_Gln502del | disruptive_inframe_deletion | Exon 5 of 10 | ENSP00000349076.3 | P54259 | ||
| ATN1 | c.1473_1508delGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA | p.Gln491_Gln502del | disruptive_inframe_deletion | Exon 5 of 11 | ENSP00000552299.1 |
Frequencies
GnomAD3 genomes AF: 0.0000207 AC: 3AN: 145034Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000153 AC: 22AN: 1438920Hom.: 0 AF XY: 0.0000153 AC XY: 11AN XY: 716734 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.0000207 AC: 3AN: 145134Hom.: 0 Cov.: 0 AF XY: 0.0000142 AC XY: 1AN XY: 70474 show subpopulations
Age Distribution
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.