chr13-110457271-G-GATGCCCTGCGTCTGCGTGGGACCCCAGGCGTCCGTGGGGCTC

Position:

• chr13-110457271-G-GATGCCCTGCGTCTGCGTGGGACCCCAGGCGTCCGTGGGGCTC

Variant summary

Our verdict is Benign. Variant got -10 ACMG points: 0P and 10B. BP6_Moderate BS1 BS2

The NM_001846.4(COL4A2):​c.1340-62_1340-21dupGTCTGCGTGGGACCCCAGGCGTCCGTGGGGCTCATGCCCTGC variant causes a intron change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.0195 in 52,366 control chromosomes in the GnomAD database, including 123 homozygotes. Variant has been reported in ClinVar as Likely benign (★).

• Frequency:
  • Genomes: 𝑓 0.019 (123 hom., cov: 30)
  • Exomes 𝑓: 0.037 (1373 hom.)
  • Failed GnomAD Quality Control
• Consequence: COL4A2 NM_001846.4 intron
• Clinical Significance: Likely benign criteria provided, single submitter B:1
• Conservation: PhyloP100: -0.294

Genes affected

COL4A2 (HGNC:2203): (collagen type IV alpha 2 chain) This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. The C-terminal portion of the protein, known as canstatin, is an inhibitor of angiogenesis and tumor growth. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jul 2008]

COL4A2-AS2 (HGNC:39849): (COL4A2 antisense RNA 2)

ACMG classification

Verdict is Benign. Variant got -10 ACMG points.

• BP6: Variant 13-110457271-G-GATGCCCTGCGTCTGCGTGGGACCCCAGGCGTCCGTGGGGCTC is Benign according to our data. Variant chr13-110457271-G-GATGCCCTGCGTCTGCGTGGGACCCCAGGCGTCCGTGGGGCTC is described in ClinVar as [Likely_benign]. Clinvar id is 1198629.Status of the report is criteria_provided_single_submitter, 1 stars.
• BS1: Variant frequency is greater than expected in population afr. gnomad4 allele frequency = 0.0195 (1019/52366) while in subpopulation AFR AF= 0.0353 (441/12490). AF 95% confidence interval is 0.0326. There are 123 homozygotes in gnomad4. There are 474 alleles in male gnomad4 subpopulation. Median coverage is 30. This position pass quality control queck.
• BS2: High AC in GnomAd4 at 1019 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	MANE	Protein	UniProt
COL4A2	NM_001846.4	c.1340-62_1340-21dupGTCTGCGTGGGACCCCAGGCGTCCGTGGGGCTCATGCCCTGC		intron_variant		ENST00000360467.7	NP_001837.2
COL4A2-AS2	NR_171022.1	n.605_646dupGAGCCCCACGGACGCCTGGGGTCCCACGCAGACGCAGGGCAT		non_coding_transcript_exon_variant	5/5

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	#exon/exons	TSL	MANE	Protein	Appris	UniProt
COL4A2	ENST00000360467.7	c.1340-62_1340-21dupGTCTGCGTGGGACCCCAGGCGTCCGTGGGGCTCATGCCCTGC		intron_variant		5	NM_001846.4	ENSP00000353654.5
COL4A2	ENST00000617564.2	c.596-62_596-21dupGTCTGCGTGGGACCCCAGGCGTCCGTGGGGCTCATGCCCTGC		intron_variant		6		ENSP00000481492.3
COL4A2-AS2	ENST00000458403.2	n.605_646dupGAGCCCCACGGACGCCTGGGGTCCCACGCAGACGCAGGGCAT		non_coding_transcript_exon_variant	5/5	2

Frequencies

GnomAD3 genomes AF: 0.0194 AC: 1015 AN: 52338 Hom.: 122 Cov.: 30

Gnomad AFR AF: 0.0352

Gnomad AMI AF: 0.00719

Gnomad AMR AF: 0.0114

Gnomad ASJ AF: 0.0310

Gnomad EAS AF: 0.00503

Gnomad SAS AF: 0.00880

Gnomad FIN AF: 0.00503

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0182

Gnomad OTH AF: 0.0110

GnomAD3 exomes AF: 0.0205 AC: 1081 AN: 52774 Hom.: 94 AF XY: 0.0209 AC XY: 569 AN XY: 27202

Gnomad AFR exome AF: 0.0445

Gnomad AMR exome AF: 0.00813

Gnomad ASJ exome AF: 0.0173

Gnomad EAS exome AF: 0.00817

Gnomad SAS exome AF: 0.0167

Gnomad FIN exome AF: 0.00215

Gnomad NFE exome AF: 0.0371

Gnomad OTH exome AF: 0.0247

GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0375 AC: 9092 AN: 242632 Hom.: 1373 Cov.: 7 AF XY: 0.0360 AC XY: 4726 AN XY: 131188

Gnomad4 AFR exome AF: 0.0588

Gnomad4 AMR exome AF: 0.00683

Gnomad4 ASJ exome AF: 0.0443

Gnomad4 EAS exome AF: 0.0104

Gnomad4 SAS exome AF: 0.0409

Gnomad4 FIN exome AF: 0.0178

Gnomad4 NFE exome AF: 0.0468

Gnomad4 OTH exome AF: 0.0430

GnomAD4 genome AF: 0.0195 AC: 1019 AN: 52366 Hom.: 123 Cov.: 30 AF XY: 0.0183 AC XY: 474 AN XY: 25882

Gnomad4 AFR AF: 0.0353

Gnomad4 AMR AF: 0.0117

Gnomad4 ASJ AF: 0.0310

Gnomad4 EAS AF: 0.00504

Gnomad4 SAS AF: 0.00884

Gnomad4 FIN AF: 0.00503

Gnomad4 NFE AF: 0.0183

Gnomad4 OTH AF: 0.0109

ClinVar

Significance: Likely benign

Submissions summary: Benign:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Benign:1

Likely benign, criteria provided, single submitter

clinical testing

GeneDx

Mar 10, 2019

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs759253067; hg19: chr13-111109618;