chr13-20189513-GATCTTTCCAATGCTGGTGGAGTGTTTGTTCACACCCCC-G
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_004004.6(GJB2):c.31_68delGGGGGTGTGAACAAACACTCCACCAGCATTGGAAAGAT(p.Gly11LeufsTer24) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000198 in 1,614,076 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★). Synonymous variant affecting the same amino acid position (i.e. G11G) has been classified as Likely benign. The gene GJB2 is included in the ClinGen Criteria Specification Registry.
Frequency
Consequence
NM_004004.6 frameshift
Scores
Clinical Significance
Conservation
Publications
- Bart-Pumphrey syndromeInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- ichthyosis, hystrix-like, with hearing lossInheritance: AD Classification: DEFINITIVE, STRONG Submitted by: G2P, Genomics England PanelApp
- keratoderma hereditarium mutilansInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, G2P, Genomics England PanelApp
- palmoplantar keratoderma-deafness syndromeInheritance: AD Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, G2P
- syndromic genetic hearing lossInheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
- autosomal recessive nonsyndromic hearing loss 1AInheritance: AR Classification: DEFINITIVE, STRONG Submitted by: G2P, Labcorp Genetics (formerly Invitae), Laboratory for Molecular Medicine
- nonsyndromic genetic hearing lossInheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
- autosomal dominant keratitis-ichthyosis-hearing loss syndromeInheritance: AD Classification: STRONG, MODERATE Submitted by: Ambry Genetics, Genomics England PanelApp
- autosomal dominant nonsyndromic hearing loss 3AInheritance: AD Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Ambry Genetics
- autosomal dominant nonsyndromic hearing lossInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- KID syndromeInheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet
- hearing loss, autosomal recessiveInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_004004.6. You can select a different transcript below to see updated ACMG assignments.
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| GJB2 | TSL:1 MANE Select | c.31_68delGGGGGTGTGAACAAACACTCCACCAGCATTGGAAAGAT | p.Gly11LeufsTer24 | frameshift | Exon 2 of 2 | ENSP00000372299.4 | P29033 | ||
| GJB2 | TSL:6 | c.31_68delGGGGGTGTGAACAAACACTCCACCAGCATTGGAAAGAT | p.Gly11LeufsTer24 | frameshift | Exon 1 of 1 | ENSP00000372295.1 | P29033 | ||
| GJB2 | c.31_68delGGGGGTGTGAACAAACACTCCACCAGCATTGGAAAGAT | p.Gly11LeufsTer24 | frameshift | Exon 2 of 2 | ENSP00000576289.1 |
Frequencies
GnomAD3 genomes AF: 0.0000131 AC: 2AN: 152206Hom.: 0 Cov.: 32 show subpopulations
GnomAD2 exomes AF: 0.0000200 AC: 5AN: 250064 AF XY: 0.00000739 show subpopulations
GnomAD4 exome AF: 0.0000205 AC: 30AN: 1461870Hom.: 0 AF XY: 0.0000193 AC XY: 14AN XY: 727234 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
Age Distribution
GnomAD4 genome AF: 0.0000131 AC: 2AN: 152206Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0AN XY: 74366 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.