rs397516873

Variant names:

• chr13-20189513-GATCTTTCCAATGCTGGTGGAGTGTTTGTTCACACCCCC-G
• rs397516873
• NM_004004.6:c.31_68delGGGGGTGTGAACAAACACTCCACCAGCATTGGAAAGAT

Variant summary

Our verdict is Pathogenic. Variant got 16 ACMG points: 16P and 0B. PVS1 PP5_Very_Strong

The NM_004004.6(GJB2):​c.31_68delGGGGGTGTGAACAAACACTCCACCAGCATTGGAAAGAT​(p.Gly11LeufsTer24) variant causes a frameshift change involving the alteration of a conserved nucleotide. The variant allele was found at a frequency of 0.0000198 in 1,614,076 control chromosomes in the GnomAD database, with no homozygous occurrence. Variant has been reported in ClinVar as Likely pathogenic (★★).

• Frequency:
  • Genomes: 𝑓 0.000013 (0 hom., cov: 32)
  • Exomes 𝑓: 0.000021 (0 hom.)
• Consequence: GJB2 NM_004004.6 frameshift
• Clinical Significance: Pathogenic/Likely pathogenic criteria provided, multiple submitters, no conflicts P:10
• Conservation: PhyloP100: 9.26

Genes affected

GJB2 (HGNC:4284): (gap junction protein beta 2) This gene encodes a member of the gap junction protein family. The gap junctions were first characterized by electron microscopy as regionally specialized structures on plasma membranes of contacting adherent cells. These structures were shown to consist of cell-to-cell channels that facilitate the transfer of ions and small molecules between cells. The gap junction proteins, also known as connexins, purified from fractions of enriched gap junctions from different tissues differ. According to sequence similarities at the nucleotide and amino acid levels, the gap junction proteins are divided into two categories, alpha and beta. Mutations in this gene are responsible for as much as 50% of pre-lingual, recessive deafness. [provided by RefSeq, Oct 2008]

ACMG classification

Verdict is Pathogenic. Variant got 16 ACMG points.

• PVS1: Loss of function variant, product does not undergo nonsense mediated mRNA decay. Variant is located in the 3'-most exon, not predicted to undergo nonsense mediated mRNA decay. There are 81 pathogenic variants in the truncated region.
• PP5: Variant 13-20189513-GATCTTTCCAATGCTGGTGGAGTGTTTGTTCACACCCCC-G is Pathogenic according to our data. Variant chr13-20189513-GATCTTTCCAATGCTGGTGGAGTGTTTGTTCACACCCCC-G is described in ClinVar as [Likely_pathogenic]. Clinvar id is 44738.Status of the report is criteria_provided_multiple_submitters_no_conflicts, 2 stars. Variant chr13-20189513-GATCTTTCCAATGCTGGTGGAGTGTTTGTTCACACCCCC-G is described in Lovd as [Pathogenic].

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
GJB2	NM_004004.6	c.31_68delGGGGGTGTGAACAAACACTCCACCAGCATTGGAAAGAT	p.Gly11LeufsTer24	frameshift_variant	Exon 2 of 2	ENST00000382848.5	NP_003995.2
GJB2	XM_011535049.3	c.31_68delGGGGGTGTGAACAAACACTCCACCAGCATTGGAAAGAT	p.Gly11LeufsTer24	frameshift_variant	Exon 2 of 2		XP_011533351.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
GJB2	ENST00000382848.5	c.31_68delGGGGGTGTGAACAAACACTCCACCAGCATTGGAAAGAT	p.Gly11LeufsTer24	frameshift_variant	Exon 2 of 2	1	NM_004004.6	ENSP00000372299.4
GJB2	ENST00000382844.2	c.31_68delGGGGGTGTGAACAAACACTCCACCAGCATTGGAAAGAT	p.Gly11LeufsTer24	frameshift_variant	Exon 1 of 1	6		ENSP00000372295.1

Frequencies

GnomAD3 genomes AF: 0.0000131 AC: 2 AN: 152206 Hom.: 0 Cov.: 32

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000294

Gnomad OTH AF: 0.00

GnomAD3 exomes AF: 0.0000200 AC: 5 AN: 250064 Hom.: 0 AF XY: 0.00000739 AC XY: 1 AN XY: 135304

Gnomad AFR exome AF: 0.00

Gnomad AMR exome AF: 0.00

Gnomad ASJ exome AF: 0.00

Gnomad EAS exome AF: 0.00

Gnomad SAS exome AF: 0.00

Gnomad FIN exome AF: 0.00

Gnomad NFE exome AF: 0.0000445

Gnomad OTH exome AF: 0.00

GnomAD4 exome AF: 0.0000205 AC: 30 AN: 1461870 Hom.: 0 AF XY: 0.0000193 AC XY: 14 AN XY: 727234

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.0000270

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.0000131 AC: 2 AN: 152206 Hom.: 0 Cov.: 32 AF XY: 0.00 AC XY: 0 AN XY: 74366

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000294

Gnomad4 OTH AF: 0.00

Bravo AF: 0.0000189

ClinVar

Significance: Pathogenic/Likely pathogenic

Submissions summary: Pathogenic:10

Revision: criteria provided, multiple submitters, no conflicts

Submissions by phenotype

not provided Pathogenic:4

Sep 01, 2021

CeGaT Center for Human Genetics Tuebingen

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Mar 07, 2017

Athena Diagnostics

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Oct 18, 2024

GeneDx

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; This variant is associated with the following publications: (PMID: 9336442, 12189487, 21465647, 25214170, 16380907) -

Dec 30, 2024

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This sequence change creates a premature translational stop signal (p.Gly11Leufs*24) in the GJB2 gene. While this is not anticipated to result in nonsense mediated decay, it is expected to disrupt the last 216 amino acid(s) of the GJB2 protein. This variant is present in population databases (rs397516873, gnomAD 0.005%). This premature translational stop signal has been observed in individual(s) with autosomal recessive non-syndromic deafness (PMID: 9336442, 12189487, 16380907, 21465647, 25214170). This variant is also known as 31del38. ClinVar contains an entry for this variant (Variation ID: 44738). This variant disrupts a region of the GJB2 protein in which other variant(s) (p.Leu213*) have been determined to be pathogenic (PMID: 23141775). This suggests that this is a clinically significant region of the protein, and that variants that disrupt it are likely to be disease-causing. For these reasons, this variant has been classified as Pathogenic. -

Autosomal recessive nonsyndromic hearing loss 1A Pathogenic:2

Jul 24, 2020

Natera, Inc.

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Mar 14, 2016

Counsyl

Significance: Likely pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

- -

Nonsyndromic genetic hearing loss Pathogenic:1

Jun 09, 2021

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: GJB2 c.31_68del38 (p.Gly11LeufsX24) results in a premature termination codon, predicted to cause a truncation of the encoded protein or absence of the protein due to nonsense mediated decay, which are commonly known mechanisms for disease. Truncations downstream of this position have been classified as pathogenic by our laboratory. The variant allele was found at a frequency of 2e-05 in 250064 control chromosomes. c.31_68del38 has been reported in the literature in multiple individuals affected with Non-Syndromic Hearing Loss (e.g. Denoyelle_1997, Janecke_2002, Dodson_2011, Beck_2015). These data indicate that the variant is very likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. Three other clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar after 2014 without evidence for independent evaluation. All laboratories cited the variant as pathogenic/likely pathogenic. Based on the evidence outlined above, the variant was classified as pathogenic. -

Autosomal dominant nonsyndromic hearing loss 3A Pathogenic:1

Mar 14, 2016

Counsyl

Significance: Likely pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

- -

Rare genetic deafness Pathogenic:1

Apr 17, 2012

Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

The Gly11fs variant in GJB2 has been reported in one individual with hearing los s (Denoyelle 1997). This frameshift variant is predicted to alter the protein?s amino acid sequence beginning at position 11 and lead to a premature termination codon 24 amino acids downstream. This alteration is then predicted to lead to a truncated or absent protein. In summary, this variant meets our criteria to be classified as pathogenic (http://pcpgm.partners.org/LMM). -

GJB2-related disorder Pathogenic:1

Jan 05, 2024

PreventionGenetics, part of Exact Sciences

Significance: Pathogenic

Review Status: no assertion criteria provided

Collection Method: clinical testing

The GJB2 c.31_68del38 variant is predicted to result in a frameshift and premature protein termination (p.Gly11Leufs*24). This variant was reported in several individuals with autosomal recessive deafness (Denoyelle et al. 1997. PubMed ID: 9336442; Dodson et al. 2011. PubMed ID: 21465647; Tang et al. 2006. PubMed ID: 17041943; and several other reports). This variant is reported in 0.0045% of alleles in individuals of European (Non-Finnish) descent in gnomAD. Frameshift variants in GJB2 are expected to be pathogenic and this variant has been consistently classified as pathogenic or likely pathogenic in ClinVar (https://www.ncbi.nlm.nih.gov/clinvar/variation/44738/). This variant is interpreted as pathogenic. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs397516873; hg19: chr13-20763652;