chr13-34942906-G-GCGGGGGCAGCGGTGGTGGCGGCAC

Variant names:

• chr13-34942906-G-GCGGGGGCAGCGGTGGTGGCGGCAC
• rs777552196
• NM_001385012.1:c.99_122dupTGGTGGCGGCACCGGGGGCAGCGG

Variant summary

Our verdict is Likely benign. Variant got -5 ACMG points: 0P and 5B. BP3 BS2

The NM_001385012.1(NBEA):​c.99_122dupTGGTGGCGGCACCGGGGGCAGCGG​(p.Gly41_Met42insGlyGlyGlyThrGlyGlySerGly) variant causes a disruptive inframe insertion change involving the alteration of a non-conserved nucleotide. The variant allele was found at a frequency of 0.00000539 in 1,483,726 control chromosomes in the GnomAD database, with no homozygous occurrence. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.

• Frequency:
  • Genomes: 𝑓 0.0000066 (0 hom., cov: 31)
  • Exomes 𝑓: 0.0000053 (0 hom.)
• Consequence: NBEA NM_001385012.1 disruptive_inframe_insertion
• Clinical Significance: Not reported in ClinVar
• Conservation: PhyloP100: 0.383

Genes affected

NBEA (HGNC:7648): (neurobeachin) This gene encodes a member of a large, diverse group of A-kinase anchor proteins that target the activity of protein kinase A to specific subcellular sites by binding to its type II regulatory subunits. Brain-specific expression and coat protein-like membrane recruitment of a highly similar protein in mouse suggest an involvement in neuronal post-Golgi membrane traffic. Mutations in this gene may be associated with a form of autism. This gene and its expression are frequently disrupted in patients with multiple myeloma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants may exist, but their full-length nature has not been determined.[provided by RefSeq, Feb 2011]

ACMG classification

Verdict is Likely_benign. Variant got -5 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001385012.1
• BS2: High AC in GnomAdExome4 at 7 AD gene.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
NBEA	NM_001385012.1	c.99_122dupTGGTGGCGGCACCGGGGGCAGCGG	p.Gly41_Met42insGlyGlyGlyThrGlyGlySerGly	disruptive_inframe_insertion	Exon 1 of 59	ENST00000379939.7	NP_001371941.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
NBEA	ENST00000379939.7	c.99_122dupTGGTGGCGGCACCGGGGGCAGCGG	p.Gly41_Met42insGlyGlyGlyThrGlyGlySerGly	disruptive_inframe_insertion	Exon 1 of 59	5	NM_001385012.1	ENSP00000369271.2

Frequencies

GnomAD3 genomes AF: 0.00000660 AC: 1 AN: 151450 Hom.: 0 Cov.: 31

Gnomad AFR AF: 0.00

Gnomad AMI AF: 0.00

Gnomad AMR AF: 0.00

Gnomad ASJ AF: 0.00

Gnomad EAS AF: 0.00

Gnomad SAS AF: 0.00

Gnomad FIN AF: 0.00

Gnomad MID AF: 0.00

Gnomad NFE AF: 0.0000148

Gnomad OTH AF: 0.00

GnomAD4 exome AF: 0.00000525 AC: 7 AN: 1332276 Hom.: 0 Cov.: 30 AF XY: 0.00000306 AC XY: 2 AN XY: 652940

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00000670

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome AF: 0.00000660 AC: 1 AN: 151450 Hom.: 0 Cov.: 31 AF XY: 0.00 AC XY: 0 AN XY: 73964

Gnomad4 AFR AF: 0.00

Gnomad4 AMR AF: 0.00

Gnomad4 ASJ AF: 0.00

Gnomad4 EAS AF: 0.00

Gnomad4 SAS AF: 0.00

Gnomad4 FIN AF: 0.00

Gnomad4 NFE AF: 0.0000148

Gnomad4 OTH AF: 0.00

ClinVar

Not reported in ClinVar

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs777552196; hg19: chr13-35517043;