chr13-70139383-A-ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG
Variant summary
Our verdict is Likely benign. The variant received -4 ACMG points: 0P and 4B. BS2
The ENST00000673087.1(ENSG00000288330):n.4_48dupCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG variant causes a non coding transcript exon change involving the alteration of a non-conserved nucleotide. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. No clinical diagnostic laboratories have submitted clinical-significance assessments for this variant to ClinVar.
Frequency
Consequence
ENST00000673087.1 non_coding_transcript_exon
Scores
Clinical Significance
Conservation
Publications
- spinocerebellar ataxia type 8Inheritance: AD Classification: MODERATE Submitted by: Ambry Genetics
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -4 ACMG points.
Transcripts
RefSeq
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | MANE | Protein | UniProt |
---|---|---|---|---|---|---|---|---|
ATXN8OS | NR_002717.3 | n.896_940dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | non_coding_transcript_exon_variant | Exon 5 of 5 | ||||
ATXN8OS | NR_185834.1 | n.454-7970_454-7926dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | intron_variant | Intron 3 of 4 | ||||
ATXN8OS | NR_185835.1 | n.454-7970_454-7926dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | intron_variant | Intron 3 of 6 |
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
ENSG00000288330 | ENST00000673087.1 | n.4_48dupCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG | non_coding_transcript_exon_variant | Exon 1 of 1 | ||||||
ATXN8OS | ENST00000756272.1 | n.769_813dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | non_coding_transcript_exon_variant | Exon 5 of 5 | ||||||
ATXN8OS | ENST00000660386.1 | n.451-7970_451-7926dupTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC | intron_variant | Intron 3 of 3 |
Frequencies
GnomAD3 genomes AF: 0.0000458 AC: 5AN: 109116Hom.: 0 Cov.: 0 show subpopulations
GnomAD4 exome Data not reliable, filtered out with message: AS_VQSR AF: 0.0000229 AC: 8AN: 349202Hom.: 0 Cov.: 0 AF XY: 0.0000161 AC XY: 3AN XY: 186202 show subpopulations ⚠️ The allele balance in gnomAD version 4 Exomes is significantly skewed from the expected value of 0.5.
GnomAD4 genome AF: 0.0000458 AC: 5AN: 109116Hom.: 0 Cov.: 0 AF XY: 0.0000570 AC XY: 3AN XY: 52594 show subpopulations
ClinVar
Not reported inComputational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at