chr14-50944359-G-GCTGATCTGCCGCCGCTTCTC
Variant summary
Our verdict is Pathogenic. The variant received 16 ACMG points: 16P and 0B. PVS1PP5_Very_Strong
The NM_002863.5(PYGL):c.25_44dupGAGAAGCGGCGGCAGATCAG(p.Ser15ArgfsTer21) variant causes a frameshift change. The variant allele was found at a frequency of 0.0000031 in 1,613,500 control chromosomes in the GnomAD database, with no homozygous occurrence. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★★).
Frequency
Consequence
NM_002863.5 frameshift
Scores
Clinical Significance
Conservation
Publications
- glycogen storage disease VIInheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: G2P, Genomics England PanelApp, ClinGen, Ambry Genetics, Labcorp Genetics (formerly Invitae), Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Pathogenic. The variant received 16 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_002863.5. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| PYGL | TSL:1 MANE Select | c.25_44dupGAGAAGCGGCGGCAGATCAG | p.Ser15ArgfsTer21 | frameshift | Exon 1 of 20 | ENSP00000216392.7 | P06737-1 | ||
| PYGL | TSL:1 | c.25_44dupGAGAAGCGGCGGCAGATCAG | p.Ser15ArgfsTer21 | frameshift | Exon 1 of 20 | ENSP00000431657.1 | E9PK47 | ||
| PYGL | TSL:1 | n.92_111dupGAGAAGCGGCGGCAGATCAG | non_coding_transcript_exon | Exon 1 of 5 |
Frequencies
GnomAD3 genomes AF: 0.00000657 AC: 1AN: 152238Hom.: 0 Cov.: 33 show subpopulations
GnomAD2 exomes AF: 0.00000401 AC: 1AN: 249462 AF XY: 0.00000739 show subpopulations
GnomAD4 exome AF: 0.00000274 AC: 4AN: 1461262Hom.: 0 Cov.: 32 AF XY: 0.00000413 AC XY: 3AN XY: 726978 show subpopulations
Age Distribution
GnomAD4 genome AF: 0.00000657 AC: 1AN: 152238Hom.: 0 Cov.: 33 AF XY: 0.00 AC XY: 0AN XY: 74380 show subpopulations
Age Distribution
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at