chr15-44660445-GTCAATGAGCTTTTGCAATGCC-G

Variant summary

Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4PP5_Moderate

The NM_025137.4(SPG11):​c.408_428delGGCATTGCAAAAGCTCATTGA​(p.Glu136_Ile142del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).

Frequency

Genomes: not found (cov: 32)

Consequence

SPG11
NM_025137.4 disruptive_inframe_deletion

Scores

Not classified

Clinical Significance

Pathogenic criteria provided, single submitter P:1O:1

Conservation

PhyloP100: 4.50

Publications

2 publications found
Variant links:
Genes affected
SPG11 (HGNC:11226): (SPG11 vesicle trafficking associated, spatacsin) The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
SPG11 Gene-Disease associations (from GenCC):
  • hereditary spastic paraplegia 11
    Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Orphanet, Genomics England PanelApp, Labcorp Genetics (formerly Invitae), Illumina, G2P
  • amyotrophic lateral sclerosis type 5
    Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp
  • Charcot-Marie-Tooth disease axonal type 2X
    Inheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp
  • juvenile amyotrophic lateral sclerosis
    Inheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet

Genome browser will be placed here

ACMG classification

Classification was made for transcript

Our verdict: Uncertain_significance. The variant received 4 ACMG points.

PM4
Nonframeshift variant in NON repetitive region in NM_025137.4.
PP5
Variant 15-44660445-GTCAATGAGCTTTTGCAATGCC-G is Pathogenic according to our data. Variant chr15-44660445-GTCAATGAGCTTTTGCAATGCC-G is described in ClinVar as Pathogenic. ClinVar VariationId is 41314.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene Transcript HGVSc HGVSp Effect Exon rank MANE Protein UniProt
SPG11NM_025137.4 linkc.408_428delGGCATTGCAAAAGCTCATTGA p.Glu136_Ile142del disruptive_inframe_deletion Exon 2 of 40 ENST00000261866.12 NP_079413.3

Ensembl

Gene Transcript HGVSc HGVSp Effect Exon rank TSL MANE Protein Appris UniProt
SPG11ENST00000261866.12 linkc.408_428delGGCATTGCAAAAGCTCATTGA p.Glu136_Ile142del disruptive_inframe_deletion Exon 2 of 40 1 NM_025137.4 ENSP00000261866.7 Q96JI7-1

Frequencies

GnomAD3 genomes
Cov.:
32
We have no GnomAD4 exomes data on this position. Probably position not covered by the project.
GnomAD4 genome
Cov.:
32

ClinVar

Significance: Pathogenic
Submissions summary: Pathogenic:1Other:1
Revision: criteria provided, single submitter
LINK: link

Submissions by phenotype

Hereditary spastic paraplegia Pathogenic:1
Sep 14, 2023
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Significance:Pathogenic
Review Status:criteria provided, single submitter
Collection Method:clinical testing

Variant summary: SPG11 c.408_428del21 (p.Glu136_Ile142del) results in an in-frame deletion that is predicted to remove 7 amino acids from the encoded protein. The variant was absent in 251142 control chromosomes. c.408_428del21 has been reported in the literature in multiple individuals affected with Hereditary Spastic Paraplegia, Type 11, either at a homozygous state or at a compound heterozygous state along with second pathogenic variant(s) (example, Denora_2009, Vural_2021, Elert-Dobkowska_2019, Stromillo_2011). These data indicate that the variant is very likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publications have been ascertained in the context of this evaluation (PMID: 19105190, 30778698, 21625935, 33624863). No submitters have cited clinical-significance assessments for this variant to ClinVar after 2014. Based on the evidence outlined above, the variant was classified as pathogenic. -

Hereditary spastic paraplegia 11 Other:1
-
GeneReviews
Significance:not provided
Review Status:no classification provided
Collection Method:literature only

- -

Computational scores

Source: dbNSFP v4.3

Name
Calibrated prediction
Score
Prediction
PhyloP100
4.5
Mutation Taster
=24/176
disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

Other links and lift over

dbSNP: rs312262714; hg19: chr15-44952643; API