rs312262714
Variant summary
Our verdict is Uncertain significance. The variant received 4 ACMG points: 4P and 0B. PM4PP5_Moderate
The NM_025137.4(SPG11):c.408_428delGGCATTGCAAAAGCTCATTGA(p.Glu136_Ile142del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★).
Frequency
Consequence
NM_025137.4 disruptive_inframe_deletion
Scores
Clinical Significance
Conservation
Publications
- hereditary spastic paraplegia 11Inheritance: AR Classification: DEFINITIVE, STRONG, SUPPORTIVE Submitted by: ClinGen, Labcorp Genetics (formerly Invitae), Orphanet, Genomics England PanelApp, Illumina, G2P
- amyotrophic lateral sclerosis type 5Inheritance: AR Classification: STRONG Submitted by: Labcorp Genetics (formerly Invitae), Genomics England PanelApp
- Charcot-Marie-Tooth disease axonal type 2XInheritance: AR Classification: STRONG, SUPPORTIVE Submitted by: Orphanet, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
- juvenile amyotrophic lateral sclerosisInheritance: AR Classification: SUPPORTIVE Submitted by: Orphanet
Genome browser will be placed here
ACMG classification
Our verdict: Uncertain_significance. The variant received 4 ACMG points.
Variant Effect in Transcripts
ACMG analysis was done for transcript: NM_025137.4. You can select a different transcript below to see updated ACMG assignments.
RefSeq Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SPG11 | MANE Select | c.408_428delGGCATTGCAAAAGCTCATTGA | p.Glu136_Ile142del | disruptive_inframe_deletion | Exon 2 of 40 | NP_079413.3 | |||
| SPG11 | c.408_428delGGCATTGCAAAAGCTCATTGA | p.Glu136_Ile142del | disruptive_inframe_deletion | Exon 2 of 40 | NP_001398061.1 | A0A804HID9 | |||
| SPG11 | c.408_428delGGCATTGCAAAAGCTCATTGA | p.Glu136_Ile142del | disruptive_inframe_deletion | Exon 2 of 38 | NP_001153699.1 | Q96JI7-3 |
Ensembl Transcripts
| Sel. | Gene | Transcript | Tags | HGVSc | HGVSp | Effect | Exon Rank | Protein | UniProt |
|---|---|---|---|---|---|---|---|---|---|
| SPG11 | TSL:1 MANE Select | c.408_428delGGCATTGCAAAAGCTCATTGA | p.Glu136_Ile142del | disruptive_inframe_deletion | Exon 2 of 40 | ENSP00000261866.7 | Q96JI7-1 | ||
| SPG11 | TSL:1 | c.408_428delGGCATTGCAAAAGCTCATTGA | p.Glu136_Ile142del | disruptive_inframe_deletion | Exon 2 of 38 | ENSP00000445278.2 | Q96JI7-3 | ||
| SPG11 | TSL:1 | c.408_428delGGCATTGCAAAAGCTCATTGA | p.Glu136_Ile142del | disruptive_inframe_deletion | Exon 2 of 37 | ENSP00000396110.2 | C4B7M2 |
Frequencies
GnomAD3 genomes Cov.: 32
GnomAD4 genome Cov.: 32
ClinVar
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at
MaxEntScan Visualizer can be used to analyze the impact of this mutation on the neighboring sequence.