rs312262714

Variant names:

• chr15-44660445-GTCAATGAGCTTTTGCAATGCC-G
• rs312262714
• NM_025137.4:c.408_428delGGCATTGCAAAAGCTCATTGA

Variant summary

Our verdict is Likely pathogenic. Variant got 6 ACMG points: 6P and 0B. PM2 PM4 PP5_Moderate

The NM_025137.4(SPG11):​c.408_428delGGCATTGCAAAAGCTCATTGA​(p.Glu136_Ile142del) variant causes a disruptive inframe deletion change. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★).

• Frequency: Genomes: not found (cov: 32)
• Consequence: SPG11 NM_025137.4 disruptive_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1 O:1
• Conservation: PhyloP100: 4.50

Genes affected

SPG11 (HGNC:11226): (SPG11 vesicle trafficking associated, spatacsin) The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]

ACMG classification

Verdict is Likely_pathogenic. Variant got 6 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• PM4: Nonframeshift variant in NON repetitive region in NM_025137.4.
• PP5: Variant 15-44660445-GTCAATGAGCTTTTGCAATGCC-G is Pathogenic according to our data. Variant chr15-44660445-GTCAATGAGCTTTTGCAATGCC-G is described in ClinVar as [Pathogenic]. Clinvar id is 41314.Status of the report is criteria_provided_single_submitter, 1 stars.

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
SPG11	NM_025137.4	c.408_428delGGCATTGCAAAAGCTCATTGA	p.Glu136_Ile142del	disruptive_inframe_deletion	Exon 2 of 40	ENST00000261866.12	NP_079413.3

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
SPG11	ENST00000261866.12	c.408_428delGGCATTGCAAAAGCTCATTGA	p.Glu136_Ile142del	disruptive_inframe_deletion	Exon 2 of 40	1	NM_025137.4	ENSP00000261866.7

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1 Other:1

Revision: criteria provided, single submitter

Submissions by phenotype

Hereditary spastic paraplegia Pathogenic:1

Sep 14, 2023

Women's Health and Genetics/Laboratory Corporation of America, LabCorp

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Variant summary: SPG11 c.408_428del21 (p.Glu136_Ile142del) results in an in-frame deletion that is predicted to remove 7 amino acids from the encoded protein. The variant was absent in 251142 control chromosomes. c.408_428del21 has been reported in the literature in multiple individuals affected with Hereditary Spastic Paraplegia, Type 11, either at a homozygous state or at a compound heterozygous state along with second pathogenic variant(s) (example, Denora_2009, Vural_2021, Elert-Dobkowska_2019, Stromillo_2011). These data indicate that the variant is very likely to be associated with disease. To our knowledge, no experimental evidence demonstrating an impact on protein function has been reported. The following publications have been ascertained in the context of this evaluation (PMID: 19105190, 30778698, 21625935, 33624863). No submitters have cited clinical-significance assessments for this variant to ClinVar after 2014. Based on the evidence outlined above, the variant was classified as pathogenic. -

Hereditary spastic paraplegia 11 Other:1

-

GeneReviews

Significance: not provided

Review Status: no classification provided

Collection Method: literature only

- -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs312262714; hg19: chr15-44952643;