chr16-2061962-AGGAGAGATACTTTGAACTGGT-A

Variant names:

• chr16-2061962-AGGAGAGATACTTTGAACTGGT-A
• rs137853998
• NM_000548.5:c.1220_1240delACTTTGAACTGGTGGAGAGAT

Variant summary

Our verdict is Likely pathogenic. The variant received 7 ACMG points: 7P and 0B. PM1 PM4 PP3 PP5_Moderate

The NM_000548.5(TSC2):​c.1220_1240delACTTTGAACTGGTGGAGAGAT​(p.Tyr407_Arg413del) variant causes a disruptive inframe deletion change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Synonymous variant affecting the same amino acid position (i.e. Y407Y) has been classified as Likely benign.

• Frequency: Genomes: not found (cov: 33)
• Consequence: TSC2 NM_000548.5 disruptive_inframe_deletion
• Clinical Significance: Pathogenic criteria provided, single submitter P:1 O:1
• Conservation: PhyloP100: 9.21
• Publications: 3 publications found

Genes affected

TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]

TSC2 Gene-Disease associations (from GenCC):

• tuberous sclerosis

  Inheritance: AD Classification: DEFINITIVE Submitted by: ClinGen
• tuberous sclerosis 2

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: PanelApp Australia, Laboratory for Molecular Medicine, Labcorp Genetics (formerly Invitae), G2P, Genomics England PanelApp, Ambry Genetics
• lymphangioleiomyomatosis

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp
• tuberous sclerosis complex

  Inheritance: AD Classification: SUPPORTIVE Submitted by: Orphanet

ACMG classification

Our verdict: Likely_pathogenic. The variant received 7 ACMG points.

• PM1: In a hotspot region, there are 2 aminoacids with missense pathogenic changes in the window of +-8 aminoacids around while only 6 benign, 28 uncertain in NM_000548.5
• PM4: Nonframeshift variant in NON repetitive region in NM_000548.5.
• PP3: No computational evidence supports a deleterious effect, but strongly conserved according to phyloP
• PP5: Variant 16-2061962-AGGAGAGATACTTTGAACTGGT-A is Pathogenic according to our data. Variant chr16-2061962-AGGAGAGATACTTTGAACTGGT-A is described in ClinVar as Pathogenic. ClinVar VariationId is 49145.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_000548.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TSC2	NM_000548.5	MANE Select	c.1220_1240delACTTTGAACTGGTGGAGAGAT	p.Tyr407_Arg413del	disruptive_inframe_deletion	Exon 12 of 42	NP_000539.2
	TSC2	NM_001406663.1		c.1220_1240delACTTTGAACTGGTGGAGAGAT	p.Tyr407_Arg413del	disruptive_inframe_deletion	Exon 12 of 42	NP_001393592.1
	TSC2	NM_001114382.3		c.1220_1240delACTTTGAACTGGTGGAGAGAT	p.Tyr407_Arg413del	disruptive_inframe_deletion	Exon 12 of 41	NP_001107854.1

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	TSC2	ENST00000219476.9	TSL:5 MANE Select	c.1220_1240delACTTTGAACTGGTGGAGAGAT	p.Tyr407_Arg413del	disruptive_inframe_deletion	Exon 12 of 42	ENSP00000219476.3
	TSC2	ENST00000350773.9	TSL:1	c.1220_1240delACTTTGAACTGGTGGAGAGAT	p.Tyr407_Arg413del	disruptive_inframe_deletion	Exon 12 of 41	ENSP00000344383.4
	TSC2	ENST00000401874.7	TSL:1	c.1220_1240delACTTTGAACTGGTGGAGAGAT	p.Tyr407_Arg413del	disruptive_inframe_deletion	Exon 12 of 40	ENSP00000384468.2

Frequencies

GnomAD3 genomes Cov.: 33

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 33

ClinVar

Significance: Pathogenic

Submissions summary: Pathogenic:1 Other:1

Revision: criteria provided, single submitter

Submissions by phenotype

not provided Pathogenic:1

Feb 01, 2020

CeGaT Center for Human Genetics Tuebingen

Significance: Pathogenic

Review Status: criteria provided, single submitter

Collection Method: clinical testing

Tuberous sclerosis syndrome Other:1

Tuberous sclerosis database (TSC2)

Significance: not provided

Review Status: no classification provided

Collection Method: curation

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		9.2
Mutation Taster		=0/200	disease causing (ClinVar)

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs137853998; hg19: chr16-2111963;