Our verdict is Pathogenic. Variant got 12 ACMG points: 12P and 0B. PVS1PM2PP5_Moderate
The NM_000548.5(TSC2):c.2429_2461delTCTGCAGCGTGGAGATGCCTGACATCATCATCAinsC(p.Ile810ThrfsTer62) variant causes a frameshift, missense change involving the alteration of a conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.
TSC2 (HGNC:12363): (TSC complex subunit 2) This gene is a tumor suppressor gene that encodes the growth inhibitory protein tuberin. Tuberin interacts with hamartin to form the TSC protein complex which functions in the control of cell growth. This TSC protein complex negatively regulates mammalian target of rapamycin complex 1 (mTORC1) signaling which is a major regulator of anabolic cell growth. Mutations in this gene have been associated with tuberous sclerosis and lymphangioleiomyomatosis. [provided by RefSeq, May 2022]
Verdict is Pathogenic. Variant got 12 ACMG points.
PVS1
Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
PM2
Very rare variant in population databases, with high coverage;
PP5
Variant 16-2074273-TCTGCAGCGTGGAGATGCCTGACATCATCATCA-C is Pathogenic according to our data. Variant chr16-2074273-TCTGCAGCGTGGAGATGCCTGACATCATCATCA-C is described in ClinVar as [Pathogenic]. Clinvar id is 237989.Status of the report is criteria_provided_single_submitter, 1 stars.
Review Status: criteria provided, single submitter
Collection Method: clinical testing
This sequence change deletes 33 nucleotides and inserts 1 nucleotide in exon 22 of the TSC2 mRNA (c.2429_2461delinsC), causing a frameshift at codon 810. This creates a premature translational stop signal (p.Ile810Lysfs*62) and is expected to result in an absent or disrupted protein product. While this particular variant has not been reported in the literature, truncating variants in TSC2 are known to be pathogenic (PMID: 10205261, 17304050). For these reasons, this variant has been classified as Pathogenic. -