chr16-2118044-GGCATCCACCTCGGCGGAGCCGTCT-ATCCA

Variant names:

• chr16-2118044-GGCATCCACCTCGGCGGAGCCGTCT-ATCCA
• rs1555459056
• NM_001009944.3:c.924_948delAGACGGCTCCGCCGAGGTGGATGCCinsTGGAT

Variant summary

Our verdict is Pathogenic. The variant received 10 ACMG points: 10P and 0B. PVS1 PP5_Moderate

The NM_001009944.3(PKD1):​c.924_948delAGACGGCTCCGCCGAGGTGGATGCCinsTGGAT​(p.Asp309GlyfsTer55) variant causes a frameshift, missense change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type DEL_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Pathogenic (★). Variant results in nonsense mediated mRNA decay.

• Frequency: Genomes: not found (cov: 32)
• Consequence: PKD1 NM_001009944.3 frameshift, missense
• Clinical Significance: Pathogenic criteria provided, single submitter P:1
• Conservation: PhyloP100: 2.33
• Publications: 0 publications found

Genes affected

PKD1 (HGNC:9008): (polycystin 1, transient receptor potential channel interacting) This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]

PKD1 Gene-Disease associations (from GenCC):

• autosomal dominant polycystic kidney disease

  Inheritance: AD Classification: DEFINITIVE, SUPPORTIVE Submitted by: Orphanet, ClinGen
• polycystic kidney disease 1

  Inheritance: AD Classification: DEFINITIVE, STRONG Submitted by: Laboratory for Molecular Medicine, Genomics England PanelApp, Labcorp Genetics (formerly Invitae)
• autosomal recessive polycystic kidney disease

  Inheritance: AR Classification: DEFINITIVE Submitted by: ClinGen
• Caroli disease

  Inheritance: AD Classification: STRONG Submitted by: Genomics England PanelApp

ACMG classification

Our verdict: Pathogenic. The variant received 10 ACMG points.

• PVS1: Loss of function variant, product undergoes nonsense mediated mRNA decay. LoF is a known mechanism of disease.
• PP5: Variant 16-2118044-GGCATCCACCTCGGCGGAGCCGTCT-ATCCA is Pathogenic according to our data. Variant chr16-2118044-GGCATCCACCTCGGCGGAGCCGTCT-ATCCA is described in ClinVar as Pathogenic. ClinVar VariationId is 448026.Status of the report is criteria_provided_single_submitter, 1 stars.

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001009944.3. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PKD1	NM_001009944.3	MANE Select	c.924_948delAGACGGCTCCGCCGAGGTGGATGCCinsTGGAT	p.Asp309GlyfsTer55	frameshift missense	Exon 5 of 46	NP_001009944.3	P98161-1
	PKD1	NM_000296.4		c.924_948delAGACGGCTCCGCCGAGGTGGATGCCinsTGGAT	p.Asp309GlyfsTer55	frameshift missense	Exon 5 of 46	NP_000287.4

Ensembl Transcripts

Sel.	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	PKD1	ENST00000262304.9	TSL:1 MANE Select	c.924_948delAGACGGCTCCGCCGAGGTGGATGCCinsTGGAT	p.Asp309GlyfsTer55	frameshift missense	Exon 5 of 46	ENSP00000262304.4	P98161-1
	PKD1	ENST00000423118.5	TSL:1	c.924_948delAGACGGCTCCGCCGAGGTGGATGCCinsTGGAT	p.Asp309GlyfsTer55	frameshift missense	Exon 5 of 46	ENSP00000399501.1	P98161-3
	PKD1	ENST00000488185.2	TSL:5	c.9_33delAGACGGCTCCGCCGAGGTGGATGCCinsTGGAT	p.Asp4ValfsTer236	frameshift missense	Exon 1 of 5	ENSP00000456672.1	H3BSE9

Frequencies

GnomAD3 genomes Cov.: 32

We have no GnomAD4 exomes data on this position. Probably position not covered by the project.

GnomAD4 genome Cov.: 32

ClinVar

ClinVar submissions

Significance: Pathogenic

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
1	-	-	not provided (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		2.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555459056; hg19: chr16-2168045;