chr16-30902396-C-CCCGCCGCCACCGCCTCAGCCG

Variant names:

• chr16-30902396-C-CCCGCCGCCACCGCCTCAGCCG
• rs1555485213
• NM_001330.5:c.466_486dupGCCGCCACCGCCTCAGCCGCC

Variant summary

Our verdict is Uncertain significance. Variant got 1 ACMG points: 2P and 1B. PM2 BP3

The NM_001330.5(CTF1):​c.466_486dupGCCGCCACCGCCTCAGCCGCC​(p.Ala156_Ala162dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 0.0 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: CTF1 NM_001330.5 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -0.535

Genes affected

CTF1 (HGNC:2499): (cardiotrophin 1) The protein encoded by this gene is a secreted cytokine that induces cardiac myocyte hypertrophy in vitro. It has been shown to bind and activate the ILST/gp130 receoptor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]

ACMG classification

Verdict is Uncertain_significance. Variant got 1 ACMG points.

• PM2: Very rare variant in population databases, with high coverage
• BP3: Nonframeshift variant in repetitive region in NM_001330.5

Transcripts

RefSeq

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	MANE	Protein	UniProt
CTF1	NM_001330.5	c.466_486dupGCCGCCACCGCCTCAGCCGCC	p.Ala156_Ala162dup	conservative_inframe_insertion	Exon 3 of 3	ENST00000279804.3	NP_001321.1

Ensembl

Gene	Transcript	HGVSc	HGVSp	Effect	Exon rank	TSL	MANE	Protein	Appris	UniProt
CTF1	ENST00000279804.3	c.466_486dupGCCGCCACCGCCTCAGCCGCC	p.Ala156_Ala162dup	conservative_inframe_insertion	Exon 3 of 3	1	NM_001330.5	ENSP00000279804.2
CTF1	ENST00000395019.3	c.463_483dupGCCGCCACCGCCTCAGCCGCC	p.Ala155_Ala161dup	conservative_inframe_insertion	Exon 3 of 3	1		ENSP00000378465.3

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 1110308 Hom.: 0 Cov.: 30 AF XY: 0.00 AC XY: 0 AN XY: 535110

Gnomad4 AFR exome AF: 0.00

Gnomad4 AMR exome AF: 0.00

Gnomad4 ASJ exome AF: 0.00

Gnomad4 EAS exome AF: 0.00

Gnomad4 SAS exome AF: 0.00

Gnomad4 FIN exome AF: 0.00

Gnomad4 NFE exome AF: 0.00

Gnomad4 OTH exome AF: 0.00

GnomAD4 genome Cov.: 31

ClinVar

Significance: Uncertain significance

Submissions summary: Uncertain:1

Revision: criteria provided, single submitter

Submissions by phenotype

Dilated Cardiomyopathy, Dominant Uncertain:1

Sep 28, 2017

Labcorp Genetics (formerly Invitae), Labcorp

Significance: Uncertain significance

Review Status: criteria provided, single submitter

Collection Method: clinical testing

This variant, c.466_486dup, results in the insertion of 7 amino acids to the CTF1 protein (p.Ala156_Ala162dup), but otherwise preserves the integrity of the reading frame. While this variant is not present in population databases, the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site, but this prediction has not been confirmed by published transcriptional studies. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the duplicated amino acids is currently unknown. This variant has not been reported in the literature in individuals with CTF1-related disease. -

Computational scores

Source: dbNSFP v4.3

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Publications

LitVar

Other links and lift over

dbSNP: rs1555485213; hg19: chr16-30913717;