rs1555485213

Variant names:

• chr16-30902396-C-CCCGCCGCCACCGCCTCAGCCG
• rs1555485213
• NM_001330.5:c.466_486dupGCCGCCACCGCCTCAGCCGCC

Variant summary

Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3

The NM_001330.5(CTF1):​c.466_486dupGCCGCCACCGCCTCAGCCGCC​(p.Ala156_Ala162dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).

• Frequency:
  • Genomes: not found (cov: 31)
  • Exomes 𝑓: 0.0 (0 hom.)
  • Failed GnomAD Quality Control
• Consequence: CTF1 NM_001330.5 conservative_inframe_insertion
• Clinical Significance: Uncertain significance criteria provided, single submitter U:1
• Conservation: PhyloP100: -0.535
• Publications: 0 publications found

Genes affected

CTF1 (HGNC:2499): (cardiotrophin 1) The protein encoded by this gene is a secreted cytokine that induces cardiac myocyte hypertrophy in vitro. It has been shown to bind and activate the ILST/gp130 receoptor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]

CTF1 Gene-Disease associations (from GenCC):

• dilated cardiomyopathy

  Inheritance: AD Classification: LIMITED Submitted by: ClinGen

ACMG classification

Our verdict: Likely_benign. The variant received -1 ACMG points.

• BP3: Nonframeshift variant in repetitive region in NM_001330.5

Variant Effect in Transcripts

ACMG analysis was done for transcript: NM_001330.5. You can select a different transcript below to see updated ACMG assignments.

RefSeq Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTF1	NM_001330.5	MANE Select	c.466_486dupGCCGCCACCGCCTCAGCCGCC	p.Ala156_Ala162dup	conservative_inframe_insertion	Exon 3 of 3	NP_001321.1
	CTF1	NM_001142544.3		c.463_483dupGCCGCCACCGCCTCAGCCGCC	p.Ala155_Ala161dup	conservative_inframe_insertion	Exon 3 of 3	NP_001136016.1
	CTF1	NR_165660.1		n.604_624dupGCCGCCACCGCCTCAGCCGCC		non_coding_transcript_exon	Exon 3 of 3

Ensembl Transcripts

Selected	Gene	Transcript	Tags	HGVSc	HGVSp	Effect	Exon Rank	Protein	UniProt
	CTF1	ENST00000279804.3	TSL:1 MANE Select	c.466_486dupGCCGCCACCGCCTCAGCCGCC	p.Ala156_Ala162dup	conservative_inframe_insertion	Exon 3 of 3	ENSP00000279804.2
	CTF1	ENST00000395019.3	TSL:1	c.463_483dupGCCGCCACCGCCTCAGCCGCC	p.Ala155_Ala161dup	conservative_inframe_insertion	Exon 3 of 3	ENSP00000378465.3

Frequencies

GnomAD3 genomes Cov.: 31

GnomAD4 exome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0 AN: 1110308 Hom.: 0 Cov.: 30 AF XY: 0.00 AC XY: 0 AN XY: 535110

African (AFR) AF: 0.00 AC: 0 AN: 22548

American (AMR) AF: 0.00 AC: 0 AN: 10150

Ashkenazi Jewish (ASJ) AF: 0.00 AC: 0 AN: 14562

East Asian (EAS) AF: 0.00 AC: 0 AN: 25070

South Asian (SAS) AF: 0.00 AC: 0 AN: 32774

European-Finnish (FIN) AF: 0.00 AC: 0 AN: 22614

Middle Eastern (MID) AF: 0.00 AC: 0 AN: 2966

European-Non Finnish (NFE) AF: 0.00 AC: 0 AN: 935888

Other (OTH) AF: 0.00 AC: 0 AN: 43736

GnomAD4 genome Cov.: 31

ClinVar

ClinVar submissions as Germline

Significance: Uncertain significance

Revision: criteria provided, single submitter

Pathogenic	VUS	Benign	Condition
-	1	-	Dilated Cardiomyopathy, Dominant (1)

Computational scores

Source: dbNSFP v4.9

Name	Calibrated prediction	Score	Prediction
PhyloP100		-0.54

Splicing

Find out detailed SpliceAI scores and Pangolin per-transcript scores at spliceailookup.broadinstitute.org

Other links and lift over

dbSNP: rs1555485213; hg19: chr16-30913717;