rs1555485213
Variant summary
Our verdict is Likely benign. The variant received -1 ACMG points: 0P and 1B. BP3
The NM_001330.5(CTF1):c.466_486dupGCCGCCACCGCCTCAGCCGCC(p.Ala156_Ala162dup) variant causes a conservative inframe insertion change involving the alteration of a non-conserved nucleotide. The variant was absent in control chromosomes in GnomAD project. It is difficult to determine the true allele frequency of this variant because it is of type INS_BIG, and the frequency of such variant types in population databases may be underestimated and unreliable. Variant has been reported in ClinVar as Uncertain significance (★).
Frequency
Consequence
NM_001330.5 conservative_inframe_insertion
Scores
Clinical Significance
Conservation
Publications
- dilated cardiomyopathyInheritance: AD Classification: LIMITED Submitted by: ClinGen
Genome browser will be placed here
ACMG classification
Our verdict: Likely_benign. The variant received -1 ACMG points.
Transcripts
RefSeq
Ensembl
Gene | Transcript | HGVSc | HGVSp | Effect | Exon rank | TSL | MANE | Protein | Appris | UniProt |
---|---|---|---|---|---|---|---|---|---|---|
CTF1 | ENST00000279804.3 | c.466_486dupGCCGCCACCGCCTCAGCCGCC | p.Ala156_Ala162dup | conservative_inframe_insertion | Exon 3 of 3 | 1 | NM_001330.5 | ENSP00000279804.2 | ||
CTF1 | ENST00000395019.3 | c.463_483dupGCCGCCACCGCCTCAGCCGCC | p.Ala155_Ala161dup | conservative_inframe_insertion | Exon 3 of 3 | 1 | ENSP00000378465.3 |
Frequencies
GnomAD3 genomes Cov.: 31
GnomAD4 exome Data not reliable, filtered out with message: AC0 AF: 0.00 AC: 0AN: 1110308Hom.: 0 Cov.: 30 AF XY: 0.00 AC XY: 0AN XY: 535110
GnomAD4 genome Cov.: 31
ClinVar
Submissions by phenotype
Dilated Cardiomyopathy, Dominant Uncertain:1
This variant, c.466_486dup, results in the insertion of 7 amino acids to the CTF1 protein (p.Ala156_Ala162dup), but otherwise preserves the integrity of the reading frame. While this variant is not present in population databases, the frequency information is unreliable, as metrics indicate poor data quality at this position in the ExAC database. In summary, the available evidence is currently insufficient to determine the role of this variant in disease. Therefore, it has been classified as a Variant of Uncertain Significance. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may create or strengthen a splice site, but this prediction has not been confirmed by published transcriptional studies. Experimental studies and prediction algorithms are not available for this variant, and the functional significance of the duplicated amino acids is currently unknown. This variant has not been reported in the literature in individuals with CTF1-related disease. -
Computational scores
Source:
Splicing
Find out detailed SpliceAI scores and Pangolin per-transcript scores at